ID: 1011733938

View in Genome Browser
Species Human (GRCh38)
Location 6:90295089-90295111
Sequence TCTCCCGGCGGGCCCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011733938_1011733948 0 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733948 6:90295112-90295134 CTGCGGGTCCGTCTCGCGGGTGG 0: 1
1: 0
2: 0
3: 1
4: 41
1011733938_1011733957 30 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733957 6:90295142-90295164 CGGTCCCTCTCGTTTCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 70
1011733938_1011733950 2 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733950 6:90295114-90295136 GCGGGTCCGTCTCGCGGGTGGGG 0: 1
1: 0
2: 1
3: 3
4: 36
1011733938_1011733952 10 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733952 6:90295122-90295144 GTCTCGCGGGTGGGGCGCCCCGG No data
1011733938_1011733946 -4 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733946 6:90295108-90295130 GAGACTGCGGGTCCGTCTCGCGG No data
1011733938_1011733947 -3 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733947 6:90295109-90295131 AGACTGCGGGTCCGTCTCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 28
1011733938_1011733954 27 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733954 6:90295139-90295161 CCCCGGTCCCTCTCGTTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 123
1011733938_1011733949 1 Left 1011733938 6:90295089-90295111 CCGCCCGCGGGCCCGCCGGGAGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1011733949 6:90295113-90295135 TGCGGGTCCGTCTCGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011733938 Original CRISPR TCTCCCGGCGGGCCCGCGGG CGG (reversed) Intronic
900125338 1:1066690-1066712 TCACCCGTCGGGCCTGGGGGAGG + Intergenic
900633903 1:3652527-3652549 CCTCCGGGCGGGTGCGCGGGCGG - Exonic
906325605 1:44843430-44843452 CCTCCCTGGGGCCCCGCGGGCGG - Intergenic
913660328 1:121001387-121001409 ACTCCAGGCGGGCCCTGGGGCGG + Intergenic
914011693 1:143784544-143784566 ACTCCAGGCGGGCCCTGGGGCGG + Intergenic
914166139 1:145176590-145176612 ACTCCAGGCGGGCCCTGGGGCGG - Intergenic
914648370 1:149675126-149675148 TCTGCGGGCGGGCAGGCGGGAGG + Intergenic
914650319 1:149693203-149693225 ACTCCAGGCGGGCCCTGGGGCGG + Intergenic
919657826 1:200214528-200214550 GCTCCCGGCCTGCCCGCTGGAGG - Intergenic
922025180 1:221742872-221742894 TCTGCGGGCGGGCGGGCGGGAGG - Intergenic
922612447 1:226940409-226940431 GCACGCGGCGGGCCGGCGGGTGG - Intronic
1063944805 10:11165855-11165877 TGTCCCGGCGGGCAGGCGGGCGG - Intronic
1066186134 10:33012492-33012514 TCTCCCAGCAGGCCGGTGGGAGG + Intergenic
1067061017 10:43077929-43077951 TATCACGGCGGCCCCTCGGGGGG - Intronic
1074088377 10:110225970-110225992 TCTCCCCGCGAGCACGGGGGAGG - Intronic
1076657965 10:132036914-132036936 TCTCCCGGCGGTCCCCCCGTGGG + Intergenic
1080609716 11:33893256-33893278 TCTCCCGGCGCAGCCGCGGCAGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081831468 11:46119881-46119903 CCCCCCGGCGGGGGCGCGGGCGG + Intronic
1083618014 11:64035936-64035958 GCGCCCGGCGGAGCCGCGGGAGG - Intronic
1084021348 11:66420072-66420094 TCTCCCCGCGGGCCGGGGGCGGG - Intergenic
1084526663 11:69702469-69702491 TCTGCGCGCGGGGCCGCGGGAGG + Intronic
1085507192 11:77067222-77067244 TTTCCCCCCGGGCCCGCGGGAGG - Intronic
1093728706 12:22544207-22544229 TCTCCCGCCGGCCCCGCGCTCGG - Intronic
1097981758 12:65742568-65742590 GCTCCCGGGTGGCCCGCGCGTGG - Intergenic
1105327503 13:19383317-19383339 ACTCCCGGCCTGCCCGCTGGAGG - Intergenic
1108622200 13:52195416-52195438 ATTCCCCGCGGGCGCGCGGGAGG + Intergenic
1109994602 13:70107596-70107618 TCCACCGGCGGCCCGGCGGGGGG - Exonic
1114422709 14:22598174-22598196 GCTCGCGGCGGGCCGGCGGTCGG - Intergenic
1115592111 14:34874612-34874634 GGTCCAGGCGAGCCCGCGGGCGG - Exonic
1115651165 14:35403981-35404003 GCGCCCGCCGGGGCCGCGGGGGG - Intronic
1116916716 14:50532471-50532493 GCTGCCGGCCGGCGCGCGGGAGG - Exonic
1117723154 14:58646547-58646569 GTTCCCGGCAGGCCCGCGGGCGG + Exonic
1121645886 14:95516739-95516761 TCTCCCGCGGGGCCACCGGGCGG - Intronic
1122494097 14:102139789-102139811 TCGCAGGGCTGGCCCGCGGGTGG + Intronic
1124789862 15:32717781-32717803 TCTCCCAGCCGGCCCGGGCGGGG + Intergenic
1137300504 16:47143912-47143934 TCCCGCGCCGGGGCCGCGGGCGG - Exonic
1138619008 16:58197511-58197533 CCTCCCTGCGGGCCCGCGGAGGG + Intronic
1139750351 16:69106168-69106190 TCTCCTGGCGGGCACGCGCCGGG + Intronic
1141231245 16:82169910-82169932 TCTCTCAGGAGGCCCGCGGGCGG - Intronic
1142212171 16:88813432-88813454 TCTCCCAGATGGCCCGAGGGGGG + Intergenic
1143541637 17:7572912-7572934 CCTTCCGACGGGCCCGCCGGGGG + Intronic
1146198275 17:30831877-30831899 TCCCTCGGCGAACCCGCGGGAGG - Intergenic
1147141896 17:38464970-38464992 TCTCTCGGCTGGCTGGCGGGAGG - Intronic
1147740848 17:42670219-42670241 TCGCGCGGCGGGGCCGGGGGCGG + Exonic
1148556627 17:48582324-48582346 TTGCCCGGCGCGTCCGCGGGCGG - Intronic
1148911363 17:50944759-50944781 TCCCCCGCCCGCCCCGCGGGAGG + Intergenic
1157095224 18:44680614-44680636 GATTCCGGCGGGCCGGCGGGTGG + Intronic
1158954150 18:62523569-62523591 CCCCGCGACGGGCCCGCGGGCGG - Exonic
1160864534 19:1251001-1251023 TGTCCCCGGAGGCCCGCGGGGGG - Intronic
1160887043 19:1354964-1354986 GCTCCCCGCGGGGCCGGGGGCGG - Intronic
1162520811 19:11178432-11178454 CCTCCAGGCGGGCCCCCGGCAGG - Exonic
1162783954 19:13022715-13022737 ACTCCCGGCGGGCTGGCGGGCGG - Intronic
1166358708 19:42242605-42242627 TCTCCCGGCGTGCCCCGCGGCGG - Intronic
1166869745 19:45864197-45864219 TCTCCTGGCGATCCCGCAGGGGG + Intronic
1167001208 19:46746520-46746542 TCCCCCGCCGGGCGCGCGCGCGG - Exonic
1167688304 19:50969720-50969742 TCTTCCGGCGGGCAGGCGGGAGG + Intergenic
1168408045 19:56120930-56120952 GCGCCCGGGCGGCCCGCGGGCGG - Intronic
931694198 2:64859779-64859801 TGTCCCGGCGGGGCCGGGGCCGG + Intergenic
935301620 2:101697939-101697961 TCTCCTCGCGGGGCCGCGGGCGG - Intronic
935590623 2:104843530-104843552 TCTCCTGGCAGAGCCGCGGGAGG + Intergenic
937221729 2:120346037-120346059 CCTCCCGGCGGGCGGGCGGGCGG + Intergenic
1173821157 20:46021643-46021665 TCTCGCGGGGGGCGGGCGGGCGG + Intergenic
1175859793 20:62143926-62143948 TCTGCGGGCGGGCGCGCGCGGGG + Intronic
1178327881 21:31660023-31660045 TCACCGGGCGGGCCCGGGCGCGG + Intronic
1179788122 21:43741171-43741193 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788139 21:43741206-43741228 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788144 21:43741217-43741239 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788155 21:43741240-43741262 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788160 21:43741251-43741273 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788183 21:43741298-43741320 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788194 21:43741321-43741343 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788246 21:43741425-43741447 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179788257 21:43741448-43741470 GCTCGCGGGGGGCTCGCGGGGGG + Intronic
1179828664 21:43982598-43982620 TCTCCACGCGCGCCCGTGGGAGG + Exonic
1181060572 22:20280330-20280352 TCTCCTGGCGGGCCGGGGCGGGG - Intronic
1183445255 22:37849350-37849372 TTTCCCGGCAGGCCCGAGTGGGG + Exonic
1185259361 22:49853315-49853337 TCCCCCGGGGGGGCCGCGCGGGG + Intergenic
952416767 3:33096913-33096935 CCGCCCTGCGGGACCGCGGGTGG + Intronic
954412360 3:50376346-50376368 TCTCCAGCCAGGCCCGCAGGCGG + Intronic
954442718 3:50530553-50530575 GCACCCTGCGGGCCCGGGGGCGG - Intergenic
964375118 3:156041680-156041702 TCTCCCACCGGGGCCGCAGGTGG - Intronic
967762430 3:193241113-193241135 TTCCCCGGCGGGCGGGCGGGCGG + Exonic
977932183 4:102761035-102761057 TCTCCGGGCGCAGCCGCGGGCGG + Intergenic
985805441 5:2039517-2039539 CCTCCTGGAGGGCCCTCGGGAGG - Intergenic
1000357985 5:160419156-160419178 TTTCCTGGCGGGGCCGGGGGCGG + Exonic
1001652793 5:173327686-173327708 CATCCCGGCCGGCACGCGGGAGG - Intronic
1004229063 6:13814552-13814574 TTTCCTGCCGGGCGCGCGGGCGG + Exonic
1008430437 6:51410584-51410606 TCTCCTGGCGGGCCCGGCGGCGG - Intergenic
1011733938 6:90295089-90295111 TCTCCCGGCGGGCCCGCGGGCGG - Intronic
1015244763 6:131063312-131063334 TCGTCCGGCGGGGTCGCGGGAGG - Exonic
1018718528 6:166554587-166554609 ACTCGCGGCTGGCACGCGGGTGG + Intronic
1019828124 7:3300927-3300949 TCCCGTGGCGGGCTCGCGGGCGG - Intergenic
1023435262 7:40135070-40135092 TCTCCGGCCGGGGCGGCGGGAGG + Exonic
1024472157 7:49775404-49775426 CGTCCCGGCGGGCGGGCGGGCGG - Exonic
1027029044 7:74875021-74875043 GCTCCCGGCAGGCCCGGGTGGGG - Intergenic
1027190798 7:75994539-75994561 TCGCCCAGCGGGCCCGGGGGCGG + Exonic
1029693991 7:102201424-102201446 TCTCCCGGCGGGCTTGCTGCAGG - Exonic
1031899229 7:127392065-127392087 TCTTAGGGCGGGCCGGCGGGCGG + Intronic
1032401793 7:131629209-131629231 CCTCCCGCCTGGCCCTCGGGTGG - Intergenic
1032819368 7:135510239-135510261 ACTCCCGGCGTGCCCCTGGGAGG - Intergenic
1034417983 7:150975152-150975174 TCCTCCGCCTGGCCCGCGGGCGG + Intronic
1034622167 7:152464353-152464375 TTTCCCCGCGAGGCCGCGGGGGG - Intergenic
1037815363 8:22109108-22109130 AGGCCCGGCGGGCCCGGGGGCGG + Intronic
1044248995 8:89984524-89984546 CCTCCTGCCGGGCCCGCGGCGGG + Exonic
1045063533 8:98427193-98427215 GCGCCCGGCGGGCCGGCGGGCGG - Exonic
1047998583 8:130358606-130358628 TCCCGCGGCGGGCGGGCGGGCGG + Intronic
1049419674 8:142511128-142511150 GCTGCCGGCGGGCCTGCGGGTGG + Intronic
1051404939 9:16727112-16727134 TGCGCCGGCGGGCCGGCGGGCGG + Intronic
1060713041 9:125889782-125889804 CCTCCCGGCGCGAACGCGGGAGG + Intronic
1060827788 9:126696378-126696400 GCTCCCTGCAGGCCCGCGTGGGG + Exonic
1062165524 9:135105556-135105578 GCTCCAGGCTGGCCCCCGGGAGG - Intronic
1187915374 X:24149259-24149281 TCTCCAGGGAGGCCCCCGGGGGG + Intronic
1189695345 X:43656243-43656265 TCCCCCGGGGAGCCCGGGGGCGG - Exonic
1197448477 X:126581122-126581144 TGGCCCCGCGGGCCCGGGGGCGG - Intergenic
1200082907 X:153588137-153588159 ACTCCCGGCCTGCCCGCTGGAGG + Exonic