ID: 1011734213

View in Genome Browser
Species Human (GRCh38)
Location 6:90296249-90296271
Sequence ATTCGGCGCGGCGCGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011734202_1011734213 14 Left 1011734202 6:90296212-90296234 CCTCGGCCGCCGTAAACAGCCGG 0: 1
1: 0
2: 1
3: 2
4: 26
Right 1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1011734208_1011734213 5 Left 1011734208 6:90296221-90296243 CCGTAAACAGCCGGGAGGGAGAG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1011734207_1011734213 8 Left 1011734207 6:90296218-90296240 CCGCCGTAAACAGCCGGGAGGGA 0: 1
1: 0
2: 1
3: 8
4: 178
Right 1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1011734209_1011734213 -5 Left 1011734209 6:90296231-90296253 CCGGGAGGGAGAGCACACATTCG 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011734213 Original CRISPR ATTCGGCGCGGCGCGGCCGC CGG Intronic
900581644 1:3412585-3412607 ATCCGGCGAGGAGCAGCCGCTGG + Exonic
904080953 1:27872427-27872449 CTTCGGCGGGGCGGGGCTGCAGG + Intergenic
904822719 1:33256125-33256147 CTCCGGCGCGGCGCGGGCGGGGG + Intergenic
905369198 1:37474394-37474416 GTCCGGCGCGCAGCGGCCGCGGG + Intergenic
905775594 1:40665500-40665522 AGTAGGCGCGGCCCGGCCCCAGG + Exonic
906027147 1:42682965-42682987 GGTCGGCGGCGCGCGGCCGCAGG - Intronic
913581660 1:120233053-120233075 ACTCGGAGCGGCGCGGCGCCCGG - Intergenic
913626517 1:120665335-120665357 ACTCGGAGCGGCGCGGCGCCCGG + Intergenic
917936946 1:179877781-179877803 ATTCGGGCCGCGGCGGCCGCTGG - Exonic
917975587 1:180235555-180235577 CTTCGGAGCGGGGAGGCCGCCGG + Intronic
918265656 1:182839482-182839504 ATGCGGGGCGGCGGGGTCGCGGG + Intronic
919486885 1:198157197-198157219 GCTCGGCGCGGCGCCGCCGTCGG - Exonic
921355501 1:214281230-214281252 TGGCGGCGGGGCGCGGCCGCCGG - Exonic
1064230844 10:13528665-13528687 AGTCGGCGAGGGGAGGCCGCGGG + Intronic
1065214771 10:23439148-23439170 CTTCGGCCCGCGGCGGCCGCTGG - Intergenic
1065590683 10:27258820-27258842 ATTCGGTGCAGCGAGTCCGCGGG + Intergenic
1077008453 11:369726-369748 ATGCGGCGCGGGGCGGGCGGGGG + Intergenic
1077214504 11:1389802-1389824 GTTCGGCTCGGCTCGGCTGCTGG + Intergenic
1077214514 11:1389871-1389893 GTTCGGCTCGGCTCGGCTGCTGG + Intergenic
1077877276 11:6319402-6319424 ATCCGGTGCGCCGCAGCCGCTGG + Exonic
1078891322 11:15561010-15561032 ACTCGGAGCGGAGCGGCCTCGGG + Intergenic
1083571493 11:63764134-63764156 ACTCGGGGCGGGGCGGCCCCAGG + Exonic
1083684496 11:64368386-64368408 ATGGGGCGTGGCGGGGCCGCGGG + Intronic
1086888241 11:92226776-92226798 ATTGGGCGCGCGGCGGCGGCGGG - Intergenic
1090699148 11:129279151-129279173 CGGCGGCGCGGCGGGGCCGCGGG - Intronic
1103749740 12:123150751-123150773 ACCCCGCTCGGCGCGGCCGCGGG + Intergenic
1119410324 14:74426187-74426209 AGTCGGCGCGGAGCCGCCTCGGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120704786 14:87735034-87735056 ACTCGGGGCGGCGGGGCGGCCGG - Intergenic
1124500466 15:30223357-30223379 CTGCGGCGCGGCTCCGCCGCCGG - Intergenic
1124743108 15:32315310-32315332 CTGCGGCGCGGCTCCGCCGCCGG + Intergenic
1125522909 15:40358144-40358166 AATGGGCGCGGCGCCGCTGCCGG - Intergenic
1126406931 15:48331646-48331668 GTGCTGCGCGGCGCGGCCGAGGG - Exonic
1133011062 16:2912108-2912130 ATCCGCCGCGGCGCTGTCGCGGG + Exonic
1135135773 16:19884732-19884754 CGTCGGCGCTGCGGGGCCGCGGG - Exonic
1137531661 16:49282034-49282056 ATTAGGCGCGGCGAGGCGGGTGG + Intergenic
1138533704 16:57648724-57648746 ATCCTGCGTGGCGCGGCAGCTGG - Intronic
1139534611 16:67563347-67563369 AGTCCGCGCGTCGCCGCCGCTGG + Intronic
1142623732 17:1179936-1179958 GCTGGGCTCGGCGCGGCCGCTGG - Intronic
1144759690 17:17700399-17700421 GGGCGGCGGGGCGCGGCCGCTGG - Intronic
1147110260 17:38256774-38256796 AGTCGGGGCTGGGCGGCCGCAGG - Intergenic
1147971095 17:44219443-44219465 ACCCGGCGCAGCGCGGCCTCCGG + Intronic
1149840990 17:59964810-59964832 ACTCGGCGCGGTGCGGGGGCGGG - Intronic
1151673913 17:75588458-75588480 CCTCGGCTCGGCGGGGCCGCCGG + Intergenic
1152222137 17:79074799-79074821 AGTCCCCGCCGCGCGGCCGCTGG + Intergenic
1153382621 18:4455440-4455462 CTACGGCGCGGCGCGACCGCGGG + Intergenic
1158601974 18:58863660-58863682 GTTCAGCGCGGCGCCGCCGGCGG - Intronic
1166330528 19:42075817-42075839 AGGCGGCGGAGCGCGGCCGCGGG - Intronic
1167638487 19:50668101-50668123 ATTTGGAGTGGCGCAGCCGCGGG + Exonic
926052595 2:9754294-9754316 ATTCGGGGCGGGGTGGCCTCGGG + Intergenic
927717488 2:25361959-25361981 ATTCGGAGCGGAGCCGCCGAGGG - Intergenic
927751458 2:25673717-25673739 GGTGGGCGGGGCGCGGCCGCGGG - Intergenic
930124433 2:47784182-47784204 ATTGGGCGGGGCGGGGCCGTGGG + Intronic
934882478 2:97995879-97995901 AGTCGGAGCGGAGAGGCCGCGGG + Exonic
1169483442 20:6006221-6006243 AGACCCCGCGGCGCGGCCGCAGG + Exonic
1170688274 20:18588282-18588304 CTTCGGGGCAGCGCGGCGGCCGG + Intronic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1170999320 20:21396996-21397018 ATGCGGGGCGGCGCGGCCACCGG - Exonic
1175902942 20:62367137-62367159 GCTGGGCGCGGCGCGGGCGCGGG - Exonic
1180559300 22:16602248-16602270 CTCCGGCCCGGCGCCGCCGCTGG - Intergenic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1185255109 22:49827497-49827519 CTTCGGGGCGCCGCGGCCGCGGG + Intronic
950037262 3:9895684-9895706 ATTAGGCCGGGCGCGGCGGCAGG - Intergenic
951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG + Intronic
952816661 3:37452687-37452709 GTTGCGCGCGGCTCGGCCGCCGG + Intronic
954733466 3:52685587-52685609 GTTGGGCGGGGCGCGGCGGCTGG - Intronic
968636661 4:1684424-1684446 CGTCGGCGCGGCGCGGCTGAGGG - Intergenic
972396572 4:38663871-38663893 ACGAGGCGCGGCGCGGCCGTGGG - Intergenic
981061269 4:140427623-140427645 AGTCGCTGCTGCGCGGCCGCCGG - Exonic
986330524 5:6713666-6713688 ACGCGGCGCGGGGCGGGCGCGGG - Intergenic
986928950 5:12794869-12794891 CCTCAGCGCGGCGCTGCCGCAGG - Intergenic
989638092 5:43557106-43557128 CTTCGGCGCGGCAGGGGCGCAGG + Intronic
992563241 5:77972897-77972919 GCCCGGCGCGGCGCGGCCCCCGG + Intergenic
992866245 5:80960250-80960272 AGTCGGCGCGGCGCCGGCGGTGG - Intergenic
997582889 5:135028353-135028375 ATCCAGCGCGGCGGGGACGCGGG + Exonic
998364335 5:141619002-141619024 ATGAGGCGGGGCGCGGCGGCTGG - Exonic
999248385 5:150167282-150167304 ATGCGGCGCAGCGTGGCGGCCGG + Exonic
1002160587 5:177312025-177312047 ACTCGGGGCGGGGCGGCTGCCGG - Exonic
1007072841 6:39049191-39049213 AGTCAGCGCAGGGCGGCCGCGGG - Intronic
1011734213 6:90296249-90296271 ATTCGGCGCGGCGCGGCCGCCGG + Intronic
1014230213 6:118894612-118894634 GTTCGGCGCCTGGCGGCCGCGGG + Intronic
1017672479 6:156779504-156779526 TCGCGGCGCGGCGAGGCCGCCGG - Intronic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1029444525 7:100604796-100604818 AAGAGGCGCGGTGCGGCCGCGGG + Intronic
1034617945 7:152435571-152435593 CTCCGGCCCGGCGCCGCCGCTGG + Intronic
1049554702 8:143276033-143276055 ATCCAGCGCGGAGCGGCCGGCGG + Exonic
1055757598 9:79572583-79572605 ATGCGGAGCGGCCCGGCAGCCGG + Intronic
1060601267 9:124879572-124879594 ATTCTGTGCTGCGCTGCCGCTGG - Exonic
1185747475 X:2584238-2584260 ATGCGGCGCGGGGCCGGCGCGGG - Intergenic
1186200176 X:7148419-7148441 CCTCGGCTCTGCGCGGCCGCTGG - Intergenic
1190008149 X:46759248-46759270 GTGCGGCGTGGCGCGGCCGGGGG - Intergenic
1199500376 X:148500692-148500714 CAGCGGCGCGGCGCGGCAGCCGG - Exonic