ID: 1011735470

View in Genome Browser
Species Human (GRCh38)
Location 6:90306039-90306061
Sequence CCAGGTCAGATCCTCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011735464_1011735470 23 Left 1011735464 6:90305993-90306015 CCTACTCATTCTGCTCTCAGCTA No data
Right 1011735470 6:90306039-90306061 CCAGGTCAGATCCTCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011735470 Original CRISPR CCAGGTCAGATCCTCTTTAT AGG Intergenic
No off target data available for this crispr