ID: 1011736560

View in Genome Browser
Species Human (GRCh38)
Location 6:90316341-90316363
Sequence CATTATATTCAAAAACTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011736558_1011736560 8 Left 1011736558 6:90316310-90316332 CCACTTAGAAGCCTTTTAGCTAC No data
Right 1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG No data
1011736559_1011736560 -3 Left 1011736559 6:90316321-90316343 CCTTTTAGCTACGTGTACTGCAT No data
Right 1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG No data
1011736557_1011736560 9 Left 1011736557 6:90316309-90316331 CCCACTTAGAAGCCTTTTAGCTA No data
Right 1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011736560 Original CRISPR CATTATATTCAAAAACTAGA AGG Intergenic
No off target data available for this crispr