ID: 1011738530

View in Genome Browser
Species Human (GRCh38)
Location 6:90336334-90336356
Sequence CTAATTAGCAGGTAAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011738530_1011738532 10 Left 1011738530 6:90336334-90336356 CCTGCATTTTACCTGCTAATTAG No data
Right 1011738532 6:90336367-90336389 TAAATACTTGCTACTGAGTTTGG No data
1011738530_1011738533 21 Left 1011738530 6:90336334-90336356 CCTGCATTTTACCTGCTAATTAG No data
Right 1011738533 6:90336378-90336400 TACTGAGTTTGGAATCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011738530 Original CRISPR CTAATTAGCAGGTAAAATGC AGG (reversed) Intergenic
No off target data available for this crispr