ID: 1011743867

View in Genome Browser
Species Human (GRCh38)
Location 6:90389869-90389891
Sequence CTCCTCATGCATCACAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011743867_1011743873 -10 Left 1011743867 6:90389869-90389891 CCCAAACTGTGATGCATGAGGAG No data
Right 1011743873 6:90389882-90389904 GCATGAGGAGGGACCCAGGGCGG No data
1011743867_1011743874 1 Left 1011743867 6:90389869-90389891 CCCAAACTGTGATGCATGAGGAG No data
Right 1011743874 6:90389893-90389915 GACCCAGGGCGGCCATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011743867 Original CRISPR CTCCTCATGCATCACAGTTT GGG (reversed) Intergenic
No off target data available for this crispr