ID: 1011743923

View in Genome Browser
Species Human (GRCh38)
Location 6:90390763-90390785
Sequence GTTTAAATGGAGAAAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011743923_1011743930 21 Left 1011743923 6:90390763-90390785 CCACCCATTTTCTCCATTTAAAC No data
Right 1011743930 6:90390807-90390829 TAGCACATTGTTATAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011743923 Original CRISPR GTTTAAATGGAGAAAATGGG TGG (reversed) Intergenic
No off target data available for this crispr