ID: 1011746840

View in Genome Browser
Species Human (GRCh38)
Location 6:90414593-90414615
Sequence GGGTCCACAAAATCGCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011746840_1011746845 27 Left 1011746840 6:90414593-90414615 CCACTGGGCGATTTTGTGGACCC No data
Right 1011746845 6:90414643-90414665 CTCAGTTTCACATCTATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011746840 Original CRISPR GGGTCCACAAAATCGCCCAG TGG (reversed) Intergenic
No off target data available for this crispr