ID: 1011748889

View in Genome Browser
Species Human (GRCh38)
Location 6:90435319-90435341
Sequence TGAAGTAGCCCCCATGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011748889_1011748892 22 Left 1011748889 6:90435319-90435341 CCCCTATCATGGGGGCTACTTCA No data
Right 1011748892 6:90435364-90435386 TAAACCATGAAGCATGCACTTGG No data
1011748889_1011748893 23 Left 1011748889 6:90435319-90435341 CCCCTATCATGGGGGCTACTTCA No data
Right 1011748893 6:90435365-90435387 AAACCATGAAGCATGCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011748889 Original CRISPR TGAAGTAGCCCCCATGATAG GGG (reversed) Intergenic
No off target data available for this crispr