ID: 1011752926

View in Genome Browser
Species Human (GRCh38)
Location 6:90471613-90471635
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011752926_1011752928 3 Left 1011752926 6:90471613-90471635 CCTTGGCTTGGAAGCACGTGACT No data
Right 1011752928 6:90471639-90471661 ATTTCTCTTCCATCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011752926 Original CRISPR AGTCACGTGCTTCCAAGCCA AGG (reversed) Intergenic
No off target data available for this crispr