ID: 1011758146

View in Genome Browser
Species Human (GRCh38)
Location 6:90527130-90527152
Sequence TAATCACATCAACAGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 1, 2: 9, 3: 112, 4: 736}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011758145_1011758146 -10 Left 1011758145 6:90527117-90527139 CCATTAATAAAATTAATCACATC 0: 1
1: 1
2: 2
3: 45
4: 533
Right 1011758146 6:90527130-90527152 TAATCACATCAACAGATTAAAGG 0: 1
1: 1
2: 9
3: 112
4: 736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011758146 Original CRISPR TAATCACATCAACAGATTAA AGG Intronic
901386873 1:8916014-8916036 AAATTCCATCAACAGATGAATGG + Intergenic
901645871 1:10716444-10716466 TGCTCACATCAAAAGATTCATGG + Intronic
902118453 1:14141208-14141230 TAATCACTTCAACAGTGTCATGG - Intergenic
904316057 1:29664432-29664454 AACACACATCAAAAGATTAAGGG - Intergenic
904955709 1:34281983-34282005 TATGCCCATCAACAGATGAATGG - Intergenic
906438137 1:45814815-45814837 TAATAACACCAACAAATCAAAGG - Intronic
906878908 1:49567835-49567857 TCATCACATAAACAGAATTAAGG + Intronic
906915890 1:50009382-50009404 ACATCATATCAACAGAATAAAGG + Intronic
907646552 1:56250360-56250382 TGAACAAATTAACAGATTAAAGG + Intergenic
907695024 1:56716493-56716515 TAATGGCATCATCAGATAAAAGG - Intergenic
908114417 1:60926912-60926934 AAAGCACATCAACACATCAAAGG + Intronic
908397203 1:63737028-63737050 ACATCATATCAACAGAATAAGGG - Intergenic
908455603 1:64301767-64301789 TCATTACATTAACAGAATAAAGG + Intergenic
909494545 1:76263844-76263866 AAAGCTCATCAACAGATAAAAGG - Intronic
909571389 1:77115894-77115916 TAATCTTATCAAAATATTAAAGG + Intronic
909719210 1:78748004-78748026 AAATTACATGAATAGATTAAAGG - Intergenic
909823341 1:80093924-80093946 ATATCACATCAACAGAATGAAGG - Intergenic
909876734 1:80814889-80814911 TAATCACAGCAGCATATTTATGG - Intergenic
910003411 1:82364712-82364734 TAACCACATCAACATAGTGAAGG - Intergenic
910699308 1:90055889-90055911 TCACCACATTAACAGACTAAAGG + Intergenic
910894869 1:92058472-92058494 TTACCACATTATCAGATTAAAGG + Intronic
911489283 1:98542470-98542492 CAAACACATAAACAGAATAAGGG + Intergenic
911925420 1:103824342-103824364 ACATCACATCAACAGAATGAAGG + Intergenic
911932734 1:103925450-103925472 AAATCACTTCAACATAATAAAGG - Intergenic
912328112 1:108788168-108788190 TCATCACATTAACAGAATAAAGG - Intronic
912589474 1:110801419-110801441 TTATCACATTAACAGTTTAAAGG + Intergenic
912789074 1:112633479-112633501 CAATCAACTCAACAGATGAATGG - Intronic
912856800 1:113176602-113176624 ACATCACATCAACAGAGTGAAGG + Intergenic
913648069 1:120880565-120880587 TCATCACATTAACAAGTTAAAGG - Intergenic
914078621 1:144382715-144382737 TCATCACATTAACAAGTTAAAGG + Intergenic
914100558 1:144583787-144583809 TCATCACATTAACAAGTTAAAGG - Intergenic
914173528 1:145251263-145251285 TCATCACATTAACAAGTTAAAGG + Intergenic
914298425 1:146353866-146353888 TCATCACATTAACAAGTTAAAGG + Intergenic
914528181 1:148492404-148492426 TCATCACATTAACAAGTTAAAGG + Intergenic
914638205 1:149574663-149574685 TCATCACATTAACAAGTTAAAGG - Intergenic
916030493 1:160873485-160873507 ACATCACATTAACAGAATAAAGG - Intergenic
916301511 1:163280378-163280400 AAATCACATCAACAGGATGAAGG + Intronic
916986226 1:170194285-170194307 ACATCACATCAACAGAATGAAGG - Intergenic
917003006 1:170381379-170381401 ACATCACATCAACAGAATTAAGG - Intergenic
917185108 1:172344792-172344814 GAATCACTTCAAAATATTAATGG + Intronic
917187041 1:172369343-172369365 ATATCACATCAACAGAATGAAGG + Intronic
917374075 1:174329696-174329718 ACATCACATTAACAGATTGAAGG + Intronic
917386792 1:174485611-174485633 ACATCACATCAACAGAATAAAGG - Intronic
918018161 1:180658886-180658908 ACATCATATCAACAGAGTAAAGG - Intronic
918385168 1:183999236-183999258 TTATCATATCGACAAATTAACGG - Intronic
918415768 1:184306007-184306029 ACATCATATCAACAGAATAAAGG - Intergenic
918755286 1:188333041-188333063 ACATCACATCAACAGAATAAAGG - Intergenic
919012277 1:191980929-191980951 AAACCACATCAACAGAATCAAGG - Intergenic
919289018 1:195604427-195604449 GCATCACATCAACAGAATGAAGG - Intergenic
919559876 1:199103694-199103716 ACATCACGTTAACAGATTAAAGG - Intergenic
920592765 1:207237437-207237459 ACATCACATCAACAGAATGAAGG + Intergenic
920596347 1:207275015-207275037 ACATCACATCAACAGAATGAAGG - Intergenic
920606044 1:207386970-207386992 ACATCACATCAACAGAATGAAGG + Intergenic
920879095 1:209863720-209863742 TAAACAGATAAACAGGTTAATGG + Intergenic
920990582 1:210935085-210935107 TAGTGTCATCAACAGATAAATGG + Intronic
920993982 1:210969039-210969061 TTATTACATTAACAGATGAAAGG - Intronic
921471302 1:215553256-215553278 ACATCACATCAACAGAATGAAGG - Intergenic
921533109 1:216309817-216309839 TCCTCACATCAACAGGCTAAAGG - Intronic
922086757 1:222356241-222356263 CAATCATATCAACAGAATGAAGG + Intergenic
922559370 1:226557854-226557876 ACATCACATTAACAGAATAAAGG + Intronic
922624466 1:227024346-227024368 TACTCCCATCAACAGCATAAAGG - Intronic
922634565 1:227154140-227154162 TTATCAGATTAACTGATTAAAGG + Intronic
923588021 1:235292689-235292711 CAATCACATGACCAAATTAAAGG + Intronic
1062841456 10:676130-676152 ACATCACATCAACAGAATTAAGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063780021 10:9311844-9311866 TAAACACATAAACACATTAAGGG + Intergenic
1064412309 10:15117265-15117287 CTAACATATCAACAGATTAAAGG + Intronic
1065041355 10:21700630-21700652 GTATCACATCAATAGAATAAAGG - Intronic
1065104332 10:22366163-22366185 TAATCCAATCAACAGATGAACGG + Intronic
1065327955 10:24567225-24567247 TAATCACATTAACAGAATAAAGG - Intergenic
1065407568 10:25387245-25387267 TACACACATCAACAGAATGAAGG - Intronic
1065656534 10:27957067-27957089 TGATCACTTCCAGAGATTAAAGG - Intronic
1066007631 10:31160923-31160945 AACTTACCTCAACAGATTAAAGG - Intergenic
1066153079 10:32645294-32645316 ACATCACATTAACAGAATAAAGG - Intronic
1066409857 10:35157113-35157135 AAATCACATCAACAGAATGAAGG + Intronic
1067430885 10:46244538-46244560 ATATCACATCAACAGAATGAAGG + Intergenic
1067480234 10:46590866-46590888 TCATCACATCCAAAGAATAAAGG - Intronic
1067548710 10:47217577-47217599 ACATCACATCAACAGATCGAAGG + Intergenic
1067614503 10:47750934-47750956 TCATCACATCCAAAGAATAAAGG + Intergenic
1067840542 10:49673998-49674020 ACATCACATCAACTGAATAAAGG + Intergenic
1068058876 10:52041249-52041271 TCATCACATTAACAGAATTAAGG - Intronic
1069090136 10:64190291-64190313 ACATCACATCAACAGAACAAAGG - Intergenic
1069282373 10:66670613-66670635 TAATCACATGAACCCTTTAAGGG - Intronic
1069496303 10:68906459-68906481 TAATCCCATCATAAGATTTAAGG - Intronic
1069586395 10:69606550-69606572 TCACCATATCAACAGACTAAAGG + Intergenic
1070317581 10:75330126-75330148 ACATCACATCAACAGAATGAAGG - Intergenic
1071034650 10:81230517-81230539 TAATAAAATCAACATATAAATGG + Intergenic
1071195528 10:83154539-83154561 TAATTCCAACAAGAGATTAAGGG - Intergenic
1071605942 10:86989748-86989770 TGATCATATCAACAGAATGAAGG - Intergenic
1071629908 10:87210905-87210927 TCATCACATCCAAAGAATAAAGG + Intergenic
1071667191 10:87570452-87570474 ACATCACATCAACAAAATAAAGG + Intergenic
1071935122 10:90521514-90521536 ATATCACATCAACAGAATGAAGG - Intergenic
1072164831 10:92803199-92803221 AAATCTAATCAAAAGATTAAAGG - Intergenic
1072204835 10:93194195-93194217 ATATCAGATAAACAGATTAATGG + Intergenic
1072391099 10:94987823-94987845 TAATAACATCAAGAGATGCAAGG - Intronic
1073437193 10:103526018-103526040 ATATCACATCAACAGAATGAAGG - Intronic
1074626295 10:115191489-115191511 TAATCATATCAACATAAAAATGG - Intronic
1077202107 11:1314644-1314666 ACATCACATCAACAGAATGAAGG - Intergenic
1077843114 11:5996156-5996178 TAATGTTATCAACAGATGAATGG + Intergenic
1077974901 11:7237930-7237952 TTAGCACATCAACAGGTTATAGG + Intergenic
1078589235 11:12624090-12624112 AAATCACATTAATAGATTAAAGG + Intergenic
1079113880 11:17627393-17627415 ACATCATATCAACAGAATAAAGG - Intronic
1079153853 11:17926059-17926081 TAATAACATTAACAGTTGAAGGG - Intronic
1079179998 11:18183738-18183760 TTGCCACATTAACAGATTAAAGG - Intronic
1079542818 11:21596016-21596038 TAATTATATTTACAGATTAAAGG + Intergenic
1079827894 11:25221117-25221139 CAATCACAGCAAAATATTAAGGG - Intergenic
1079845888 11:25467070-25467092 ACATCACATCAACAGACTGAAGG + Intergenic
1080377776 11:31734085-31734107 ACATCACATTAACAGATTGAGGG + Intronic
1080706095 11:34695320-34695342 ACATCACATCAACAGAATGAAGG - Intergenic
1080985807 11:37463547-37463569 ACATCACATTAACAGAATAAAGG - Intergenic
1080989959 11:37519896-37519918 GAATCACATCAATAGAATGAAGG + Intergenic
1081079725 11:38726679-38726701 CACTCACATCAACAGCATAAAGG + Intergenic
1081092788 11:38893911-38893933 TAATCAAATGAACAAATAAATGG - Intergenic
1081402514 11:42659509-42659531 TCATCAGACCAACCGATTAAAGG - Intergenic
1081504578 11:43702592-43702614 ACATCATATCAACAGAATAAAGG - Intronic
1081697850 11:45129029-45129051 TCACCACATTAACAGAATAAAGG + Intronic
1082642137 11:55675350-55675372 TCACCACCTTAACAGATTAAAGG - Intergenic
1083124390 11:60549860-60549882 CAATCGTATCAACAGAATAAAGG + Intergenic
1083692453 11:64418580-64418602 AAACCATATCAACAGATGAATGG + Intergenic
1085223874 11:74900674-74900696 ACATCACATCAACAGAATGAAGG + Intronic
1086235071 11:84619601-84619623 TAATCACATTAACACAATAGGGG + Intronic
1086503956 11:87482661-87482683 TCATCACATTAACAGAATAAAGG - Intergenic
1087080267 11:94163496-94163518 ACATCACATCAACAGAATGAAGG - Intronic
1087084847 11:94206849-94206871 ATATCACATTAACAGAATAAGGG + Intergenic
1087313829 11:96582564-96582586 ACATCACATCAACAGAATGAGGG + Intergenic
1087353572 11:97064433-97064455 GCATCACATCAACAGAGTAAAGG + Intergenic
1087371024 11:97284020-97284042 AAAACATATCAACAGAATAAAGG + Intergenic
1087381751 11:97413221-97413243 ACACCACATCAACAGAATAAAGG + Intergenic
1087394503 11:97580312-97580334 CAAATACATCAGCAGATTAATGG - Intergenic
1087644601 11:100793419-100793441 TAATCTAATAAACACATTAATGG - Intronic
1087699537 11:101419816-101419838 ACATCACATCAACAGAATGAAGG - Intergenic
1087865088 11:103215420-103215442 ATATCACATCAACAGAACAAAGG - Intronic
1087997947 11:104835110-104835132 ACAGCACATCAACAGAATAAAGG - Intergenic
1088021801 11:105129329-105129351 ACATCACATCCACAGAATAAAGG + Intergenic
1088033682 11:105284964-105284986 AATTCACATCAACAGAATGAAGG + Intergenic
1088310358 11:108453686-108453708 TGACCACATTAACAGAATAAAGG - Intronic
1089885489 11:121818199-121818221 TCATTATATCAACAGACTAAAGG - Intergenic
1090157140 11:124451458-124451480 ACATCACATCAACAGAATGAAGG + Intergenic
1091481599 12:837899-837921 TAGTGACATAAACAGATTAGGGG - Intronic
1091932689 12:4409357-4409379 TAATCAGATTAACACATTATGGG - Intergenic
1092697453 12:11189217-11189239 TCAGTACATTAACAGATTAAAGG + Intergenic
1093617534 12:21245335-21245357 ACATCATATCAACAGAATAAAGG + Intergenic
1093681799 12:22011018-22011040 ATATCACATCAACAGAATAAAGG - Intergenic
1093819957 12:23602644-23602666 AAATCACATCAATAAATCAAGGG + Intronic
1094060260 12:26307160-26307182 ACATCACATTAACAGAATAAAGG + Intergenic
1094274218 12:28652557-28652579 TAATCACACTAATAGAATAAAGG - Intergenic
1095154933 12:38841353-38841375 GAATCTCATCAACAGATAACTGG + Intronic
1095380836 12:41589592-41589614 TAATCACATCCACACCTTGAAGG + Intergenic
1095760205 12:45824141-45824163 ACATCACATCAACAGAATGAAGG + Intronic
1096275369 12:50202865-50202887 TTAGGACATCAAGAGATTAATGG + Intronic
1097568864 12:61306848-61306870 ATATCATATCAACAGAATAAAGG - Intergenic
1097718184 12:62989996-62990018 CCATCACATCAACAGGTTAAAGG - Intergenic
1098274625 12:68800780-68800802 TCACCACATAGACAGATTAAAGG + Intergenic
1098409055 12:70159770-70159792 ACATCACATCAACAGAATGAAGG + Intergenic
1098452788 12:70639141-70639163 TAATCACCCCAAGAGATTGATGG + Exonic
1098696428 12:73562951-73562973 TCATCATATCAACAGGCTAAAGG + Intergenic
1098741278 12:74176759-74176781 CATTCACATCAACAAATTCATGG + Intergenic
1099421356 12:82465376-82465398 ACATCACATCAACAGAATGAAGG - Intronic
1099762003 12:86935325-86935347 TCACCACATCAACAGGCTAAAGG + Intergenic
1100466490 12:94849878-94849900 TCCTCACATAAACAGAATAAAGG + Intergenic
1100467963 12:94864809-94864831 TAAATACATCAATAGAATAAAGG + Intergenic
1100617972 12:96246343-96246365 TAATCCCATCCACATAGTAAAGG + Intronic
1100881514 12:99022995-99023017 TCATTACATTAACAGATTAAAGG - Intronic
1100905224 12:99290641-99290663 ATATCATATCAACAGAATAAAGG + Intronic
1100923589 12:99517991-99518013 ACATCATATCAACAGAATAAAGG - Intronic
1100936064 12:99667817-99667839 TTACCACATTAACAGAATAAAGG - Intronic
1100942192 12:99735982-99736004 ATATCACATCAACAGAATGAAGG + Intronic
1101160566 12:101970247-101970269 ACATCATATCAACAGAATAAAGG + Intronic
1101691709 12:107088469-107088491 TAATAACACAAACAGACTAAGGG + Intronic
1105313298 13:19232882-19232904 AAATCTCATTAACAGAATAAAGG + Intergenic
1105558525 13:21468472-21468494 ACATCATATCAACAGAATAAAGG - Intergenic
1105726474 13:23167298-23167320 TATATTCATCAACAGATTAATGG - Intergenic
1105764210 13:23542741-23542763 TTGTCACATTAACAGATAAAAGG + Intergenic
1105793555 13:23828056-23828078 TCACTACATTAACAGATTAAAGG + Intronic
1106428974 13:29661381-29661403 TACTAACCTTAACAGATTAAAGG + Intergenic
1106661665 13:31806516-31806538 AAATCACATAAACAGATGACTGG + Intergenic
1106722734 13:32452583-32452605 TAACCACATCAGCAGGTTAAAGG + Intronic
1107062850 13:36179380-36179402 TCACCACATTAACAGAATAAAGG - Intronic
1107085603 13:36424675-36424697 ACATCATATCAACAGAATAAAGG + Intergenic
1107378116 13:39826546-39826568 TAACCACATCACAAGATGAAAGG - Intergenic
1108110042 13:47060465-47060487 TAATCACGTAAACAGAATGAAGG - Intergenic
1109086814 13:57984397-57984419 ACATCACATCAACAGAATGAAGG + Intergenic
1109156906 13:58922501-58922523 TAATCTCCTCAAGAGATTAGTGG + Intergenic
1109813898 13:67553526-67553548 TAATCAAATCAATAGAAAAAAGG + Intergenic
1109991041 13:70057959-70057981 CAATCATATCAACAGAATAAAGG + Intronic
1110194939 13:72777897-72777919 TGATCACATCAACAGATTTTTGG - Intronic
1110535599 13:76647413-76647435 TCATCACATCCACAGATTCCAGG + Intergenic
1110805201 13:79746412-79746434 TAAAAACAGGAACAGATTAAGGG + Intergenic
1110871185 13:80454045-80454067 GCATCACATCAACAGAATAAAGG + Intergenic
1111155748 13:84322183-84322205 TAATGACATCAACAGTATTAAGG + Intergenic
1111328850 13:86735674-86735696 CACTCACATCAACAGAATGAAGG + Intergenic
1111355208 13:87090944-87090966 TAGTCACAACAACACCTTAATGG + Intergenic
1111426033 13:88083711-88083733 TTACCACAATAACAGATTAAAGG - Intergenic
1112773307 13:102815931-102815953 ACATCACATCATCACATTAATGG + Intronic
1112834282 13:103494787-103494809 GAAACACCTCAAAAGATTAAAGG - Intergenic
1114068394 14:19086642-19086664 TCATCATATCAACAGAATGAAGG - Intergenic
1114093871 14:19313372-19313394 TCATCATATCAACAGAATGAAGG + Intergenic
1114350555 14:21845983-21846005 TAATCAAAGCAAACGATTAAAGG - Intergenic
1114586801 14:23822677-23822699 TCATCACATAAACAGAATTAAGG - Intergenic
1114830740 14:26138389-26138411 TAATCACAACAGCAGAGTGAGGG - Intergenic
1115100326 14:29690679-29690701 TAAACAGATCAACAGATTGGAGG - Intronic
1115210329 14:30961014-30961036 TCATCACAACTTCAGATTAAGGG + Intronic
1115287658 14:31734037-31734059 TTATCACATTAGCAGAATAAAGG - Intronic
1115415464 14:33127396-33127418 TTACCACATCAAAAGATTAAAGG - Intronic
1115729325 14:36251260-36251282 TTGTCACATGAGCAGATTAAAGG + Intergenic
1115815380 14:37158450-37158472 CTATCACATCAACAGAATGAAGG + Intronic
1115833233 14:37365480-37365502 ACATCACATCAACAGAGTGAAGG - Intronic
1116423953 14:44766842-44766864 AAATGACATCAACACATCAACGG - Intergenic
1116571536 14:46523303-46523325 TTATCACATTAACAGATTAGTGG + Intergenic
1116586431 14:46710477-46710499 AGATCACCTCAACTGATTAATGG + Intergenic
1116601920 14:46936642-46936664 ATATCACATCAACAGGATAAAGG + Intronic
1116929968 14:50680828-50680850 ACGTCACATCAACAGAATAAAGG - Intergenic
1117433286 14:55692017-55692039 TAATTACAACAACAAAATAATGG + Intronic
1117749578 14:58906588-58906610 ACATCACATCAACAGAATTAAGG + Intergenic
1118027483 14:61784370-61784392 TTACCACATCAATAGGTTAAAGG + Intronic
1119252481 14:73168713-73168735 AGATCACATGAACAGATTGAAGG - Intronic
1119276784 14:73364052-73364074 TCACCACATTAACAGAATAAAGG + Intronic
1119583429 14:75809083-75809105 GAATCACTTCAACTGATAAAAGG - Intronic
1120663730 14:87280722-87280744 AAATCTAATCATCAGATTAATGG + Intergenic
1120931501 14:89853313-89853335 TAACCAATTCATCAGATTAAAGG - Intronic
1120934795 14:89884260-89884282 TCATCACATTAACAGGGTAAAGG + Intronic
1121824111 14:96996550-96996572 TAATCAAATCACCATATTGATGG - Intergenic
1122349575 14:101079814-101079836 ACATCACATCAACAGAATGAAGG + Intergenic
1123098813 14:105780673-105780695 AAATCACATCAACAGAATGAAGG - Intergenic
1123774382 15:23564639-23564661 TAATCACATTAAGAGAATAAAGG + Intergenic
1124465051 15:29930447-29930469 TCATCACATTGACAGACTAAAGG + Intronic
1124682217 15:31742371-31742393 TTGCCACATCAACAGATTAAGGG + Intronic
1124698098 15:31884027-31884049 TCACTACATTAACAGATTAAAGG - Intergenic
1125313466 15:38405897-38405919 TCACCACATTAACAGAATAAAGG + Intergenic
1126480589 15:49114998-49115020 ACATCACATCAACAGAATGAAGG + Intronic
1126488449 15:49209605-49209627 ATATCACATCAACAGAATGAAGG - Intronic
1126862484 15:52900039-52900061 ACATCACATCAACAGAATGAAGG - Intergenic
1126979339 15:54224403-54224425 ACATCACATCAACAGAATAAAGG - Intronic
1127035514 15:54912509-54912531 TCATCAAATCAACAGAGTGAGGG + Intergenic
1127196771 15:56595072-56595094 ACATCACATCAAAAGAATAAAGG + Intergenic
1127255099 15:57283614-57283636 CAATTTTATCAACAGATTAAAGG + Intronic
1127926901 15:63555126-63555148 TGATCACTTCATCAGATGAAAGG + Intronic
1129573386 15:76714897-76714919 TTACCACATTAACGGATTAAAGG + Intronic
1129963159 15:79708081-79708103 ACATCACATCAACAGAATGAGGG - Intergenic
1130439291 15:83934797-83934819 GAATCACATCAACAAATGATTGG + Intronic
1130646379 15:85730875-85730897 TACTCACATCAAGAACTTAAAGG + Intronic
1130753450 15:86738012-86738034 ATATCACATCAACAGAATGAAGG + Intronic
1130928924 15:88406636-88406658 TCATCACATGAACAGAAAAAAGG - Intergenic
1131773502 15:95767338-95767360 TCAACGCATTAACAGATTAAAGG - Intergenic
1133395501 16:5443726-5443748 TAATCAAAGCAAAAGCTTAAAGG - Intergenic
1133426720 16:5698006-5698028 TCACCACATCAAAAGATTAAGGG - Intergenic
1133843511 16:9431885-9431907 ACATCACATCAACAGAATGAAGG - Intergenic
1133892061 16:9888874-9888896 TTACCACATTAACAGAGTAAAGG - Intronic
1134262432 16:12662770-12662792 GAATCACATCAACAGATGATTGG - Exonic
1134430312 16:14198219-14198241 AAATGTCATCAACAGATGAATGG - Intronic
1134788986 16:16971373-16971395 TAAGCACAACATCAGAGTAAAGG + Intergenic
1135884004 16:26288150-26288172 AAATCACATCGACAGAATGAAGG - Intergenic
1137544721 16:49394429-49394451 TTATTACATCAACATATTAAAGG + Intronic
1137949580 16:52770929-52770951 TAATCACAACTACAGACTAAAGG - Intergenic
1138612741 16:58140218-58140240 TTACCACATTAACAGAATAAAGG + Intergenic
1138994875 16:62438286-62438308 GCATCGCATCAACAGAATAAAGG + Intergenic
1140566669 16:76050560-76050582 TCATCACATTATCAGAATAAAGG - Intergenic
1140637467 16:76932048-76932070 TTATCTCATTAACAGAATAATGG + Intergenic
1140738510 16:77920680-77920702 TAAACACATCAACATACAAAAGG - Intronic
1140811663 16:78584778-78584800 TGATCACATCACCAGATGAATGG - Intronic
1143989920 17:10949024-10949046 TCATCACATCAACAAGCTAAAGG - Intergenic
1144194927 17:12882705-12882727 TCATCACATGCACAAATTAAAGG - Intronic
1144276199 17:13671014-13671036 ACATCACATCGACAGAATAAAGG + Intergenic
1146293010 17:31625355-31625377 TTATCTCATCAACAGCATAAAGG + Intergenic
1147518338 17:41143256-41143278 TAACCATATCAACAGGTTATGGG + Intergenic
1148655449 17:49279897-49279919 TCATCACATTAACAGATTCCAGG + Intergenic
1148761690 17:50005935-50005957 TCATCATATTAACAGAATAAAGG + Intergenic
1149093081 17:52807235-52807257 ACATCACATTAACAGAATAAAGG + Intergenic
1149339506 17:55671266-55671288 TTATTACATGAAGAGATTAATGG + Intergenic
1149943347 17:60894839-60894861 TAATCACATCAACAGAATGAAGG - Intronic
1150169985 17:62983739-62983761 AAATCACAGTAACAGAATAAAGG - Intergenic
1150541241 17:66102452-66102474 TTATAACATTAATAGATTAAAGG + Intronic
1153148546 18:2061664-2061686 TAAACAGATTAACAGATTACAGG + Intergenic
1153239725 18:3019980-3020002 TCACCACATTAAAAGATTAAAGG + Intergenic
1153388453 18:4527526-4527548 AAATCACATCAACAGAATGAAGG - Intergenic
1154097949 18:11437474-11437496 ACATCACATCAACAGAATGAAGG + Intergenic
1154308724 18:13251096-13251118 AAATCACATCAGCAGAATGAAGG + Intronic
1154380065 18:13841215-13841237 ATATCACATTAACAAATTAAAGG - Intergenic
1155279327 18:24222258-24222280 TATTAACATGAATAGATTAAAGG - Intronic
1156075202 18:33267441-33267463 TCATCACATCAACAAGTTAAAGG + Intronic
1156623626 18:38882538-38882560 TCAGCACATCAACAGATGGATGG + Intergenic
1156790927 18:40973485-40973507 ACATCACATCAACAGAATAAAGG - Intergenic
1157336410 18:46741727-46741749 TGACCACATCAAAAGGTTAAAGG + Intronic
1158257462 18:55568958-55568980 TCACGACATTAACAGATTAAAGG + Intronic
1158948492 18:62468894-62468916 TACATACATCAACAGATGAATGG - Intergenic
1159373265 18:67557532-67557554 CTATCACATCAACAGGTTAAAGG - Intergenic
1159648438 18:70947972-70947994 GCATCATATCAACAGAATAAAGG + Intergenic
1159876679 18:73819891-73819913 TTATCACATTAACAGATGAAAGG + Intergenic
1162243206 19:9375112-9375134 ACATCACATCAACAGAATGAAGG - Intronic
1165185135 19:34013041-34013063 TATACACATTAACAGAATAAAGG + Intergenic
1165343787 19:35230515-35230537 TCACCACATTAACAGAATAAAGG + Intergenic
1165656812 19:37540434-37540456 CAATCAAATTAACAGTTTAAAGG + Exonic
1167398555 19:49248613-49248635 TTATTACATTAATAGATTAAAGG - Intergenic
1167843035 19:52137804-52137826 TAATGACATCAGCTGATTACAGG + Intronic
924994582 2:346675-346697 TAATCACATTCATAGAATAAAGG - Intergenic
925638106 2:5961329-5961351 ACATCACATCAACAGAATGAAGG - Intergenic
925873219 2:8288827-8288849 TCACCACATTAACAGATTTAAGG + Intergenic
926262218 2:11275613-11275635 AAACCACATTAACAGAATAAAGG + Intronic
926519144 2:13887892-13887914 ACATCACATCAACAGAATGAAGG + Intergenic
926529083 2:14019678-14019700 TATTGACATCAACAGTTGAATGG + Intergenic
926768197 2:16342813-16342835 ACATCACATCAACAGAATGAAGG + Intergenic
927315197 2:21673734-21673756 TAAACACATAAACAGATAATTGG - Intergenic
928633581 2:33218899-33218921 CAATCAAATCAACAGATAAGAGG - Intronic
928768311 2:34674186-34674208 ACATCACATCAACAGAATGAAGG + Intergenic
928803199 2:35119353-35119375 ACATCACATAAACAGAATAAAGG + Intergenic
929184224 2:39076522-39076544 TTCTCACATTAACAGATAAAAGG + Intronic
929265802 2:39917991-39918013 ACATCACATCAACAGAATGAAGG - Intergenic
929371602 2:41230981-41231003 TTATCACATCAGCAGAATCAAGG - Intergenic
929724970 2:44415504-44415526 TAATCACATGAATAAATTAGTGG + Intronic
929734731 2:44535607-44535629 TCATCACACCAACAGAATGAAGG + Intronic
929843821 2:45501153-45501175 ACATCACATCAACAGAATCAAGG - Intronic
929847730 2:45548665-45548687 TAATCACAGCAACATAGTAAAGG + Intronic
930291227 2:49495289-49495311 GCATCACATCAACAGAATGAAGG + Intergenic
930292102 2:49507904-49507926 TCATCACATAAACAGATTAAAGG - Intergenic
930570479 2:53079663-53079685 CAATCACATTAACAGAATAAAGG + Intergenic
930593810 2:53361176-53361198 TCACCACATAAACAGAATAAAGG - Intergenic
930968676 2:57366343-57366365 TTACCACATTAACAGAATAAAGG + Intergenic
931521497 2:63102457-63102479 ATATCACATCAACAGAATGAAGG - Intergenic
932059431 2:68480882-68480904 ATATCACATCAACAGAATTAAGG - Intronic
932272276 2:70420910-70420932 TTATGACATCACCAGAATAAAGG - Intergenic
932562350 2:72884360-72884382 TAATGGAATCCACAGATTAATGG - Intergenic
932889871 2:75584243-75584265 TCATCATATCAACAGAATGAAGG + Intergenic
933345492 2:81080005-81080027 ACATCACATCAACAGAATGAAGG + Intergenic
933640893 2:84758662-84758684 ACATCACATAAACAGATTTAAGG + Intronic
934632114 2:95938384-95938406 TAATCACATCTTCTGATTACCGG - Intronic
934801392 2:97164897-97164919 TAATCACATCTTCTGATTACCGG + Intronic
934916343 2:98303852-98303874 TCATCTCAAAAACAGATTAAAGG - Intronic
935100982 2:99995886-99995908 TAAACACTTCAACAGAAAAATGG + Intronic
935356257 2:102203149-102203171 ACATCATATCAACAGAATAAAGG - Intronic
935964324 2:108458191-108458213 ATATCACATCAACAGAATAAAGG - Intronic
936027210 2:109041907-109041929 TCACCACATTAACAGAATAAAGG - Intergenic
936262182 2:110970359-110970381 CCACCACATCAACAGACTAAAGG + Intronic
936621663 2:114105847-114105869 AGTTCCCATCAACAGATTAATGG - Intergenic
937539031 2:122925738-122925760 AAGTCACATGAACAGATTGAAGG + Intergenic
938284718 2:130101922-130101944 TAATCTCATTAACAGAAGAATGG - Intronic
938335358 2:130490482-130490504 TAATCTCATTAACAGAAGAATGG - Intronic
938354465 2:130630185-130630207 TAATCTCATTAACAGAAGAATGG + Intronic
938430887 2:131236968-131236990 TAATCTCATTAACAGAAGAATGG + Intronic
938733690 2:134166683-134166705 TACACACCTCAACAAATTAAAGG + Intronic
938940818 2:136168175-136168197 TGATCACATCAAAAGATTGTGGG - Intergenic
939138695 2:138326858-138326880 TAATCACATCAATAGGATAAAGG + Intergenic
939279747 2:140047604-140047626 TCATCACATTATCAAATTAAAGG - Intergenic
939336119 2:140830470-140830492 AAATCACATTAACAGAATGAAGG + Intronic
939404829 2:141743206-141743228 TAATCATGTCAACAGAATGAAGG - Intronic
939513975 2:143143256-143143278 GAATCACTTCAAGAGACTAAAGG + Intronic
939573531 2:143868281-143868303 TCATTACATTAAAAGATTAAAGG + Intergenic
939761329 2:146184405-146184427 TTACCACATAAAAAGATTAAAGG - Intergenic
940180608 2:150928187-150928209 AAATGCCATCAACAGATGAATGG + Intergenic
940382718 2:153033882-153033904 ACATCACATCAACAGAACAAAGG + Intergenic
940558415 2:155262884-155262906 TATTCAAATCCACAGAATAAAGG + Intergenic
941058922 2:160823061-160823083 ATATCACATAAACAGAATAAAGG - Intergenic
941846072 2:170134743-170134765 ACATCACATCAACAGAATGAAGG + Intergenic
941978721 2:171432783-171432805 TAATGTCATCAACAGATTTTTGG + Intronic
942129919 2:172868141-172868163 GAATCACATGAAGAGATTATTGG + Intronic
942538670 2:176992606-176992628 ACATCACATCAACAGAATGAAGG + Intergenic
942662924 2:178285178-178285200 TAATAATAGCAACAGATTAGTGG + Intronic
942883089 2:180886630-180886652 ACATCACATCAACAGAATGAAGG + Intergenic
943128464 2:183826616-183826638 GCATTACATCAACAGATGAATGG + Intergenic
943401488 2:187416897-187416919 AAGTCAAATCAACAGATTGAAGG - Intronic
943542105 2:189229027-189229049 TCACCACATTAACAGAATAAAGG + Intergenic
944259689 2:197663113-197663135 ACATCACATCAACAGAATGAAGG - Intronic
944466743 2:200009302-200009324 TCATCACATTAACAGAATAAAGG - Intergenic
944629618 2:201610842-201610864 ACATCACATCAACAGAATTAAGG + Intronic
945095708 2:206216899-206216921 TAATGATATCAAAAGATGAAAGG - Intronic
945149601 2:206775376-206775398 ACATCATATCAACAGAATAAAGG - Intronic
945559755 2:211325174-211325196 ACATCACATCAACAGAATGAAGG + Intergenic
945575998 2:211529716-211529738 ACATCATATCAACAGAATAAAGG + Intronic
945731931 2:213548682-213548704 TAACCACATCAAAAGAAAAATGG - Intronic
947209276 2:227692422-227692444 AAATCACATCGACAGAATGAAGG + Intronic
947560232 2:231143156-231143178 TAATCTCAATGACAGATTAAAGG + Intronic
947832297 2:233150121-233150143 AAATCATATCAACAGATAAGAGG - Intronic
948776674 2:240292720-240292742 TAATCACAGCCACAGTCTAAGGG - Intergenic
948812500 2:240489549-240489571 ACATCACATCAACAGAATGAAGG - Intronic
1169829865 20:9812680-9812702 AATGCACATCAACAGATGAATGG + Intronic
1169836263 20:9883095-9883117 ACATCACATCAACAGAATGAAGG - Intergenic
1170195753 20:13687598-13687620 TAGATACATCAACAGATGAATGG - Intergenic
1170240427 20:14159994-14160016 ACATCACATCAACAGAATAAAGG - Intronic
1171510323 20:25677442-25677464 ACATCACATCAACAGAGTGAAGG + Intronic
1172173052 20:32954811-32954833 TTACCACATCAACAGGATAAAGG - Intronic
1172891068 20:38264892-38264914 ACATCACATCAACAGAATGAAGG + Intronic
1173720095 20:45250616-45250638 ACATCACATCAACAGAATGAAGG + Intergenic
1174206372 20:48842843-48842865 TAATCATAATAACAGAATAAAGG + Intergenic
1174831379 20:53815602-53815624 AAATCACATCAACAGAATGAAGG - Intergenic
1177177650 21:17717345-17717367 TCATCACATAAACAGAATTAAGG + Intergenic
1177217098 21:18144879-18144901 GAATCACATTAACAAAGTAAAGG + Intronic
1177477254 21:21639708-21639730 ACATCACATCAACAGAATGAAGG - Intergenic
1177605524 21:23372710-23372732 TAATCACTTCAGCACATTAAAGG - Intergenic
1177767756 21:25477496-25477518 TTATCAGATTATCAGATTAAGGG - Intergenic
1177771675 21:25523571-25523593 ACATCATATCAACAGAATAAAGG + Intergenic
1177974801 21:27834655-27834677 TAGGCACATCAACAAAATAAAGG - Intergenic
1179230172 21:39495874-39495896 TCATTACATGAACTGATTAATGG + Intronic
1179432365 21:41331867-41331889 TTACCACATCAACAGAATGAAGG - Intronic
1180486865 22:15809203-15809225 TCATCATATCAACAGAATGAAGG - Intergenic
1180616225 22:17129732-17129754 TTACCATATTAACAGATTAAAGG + Intronic
1181586701 22:23856456-23856478 TGATCTCATTAACAGATTAAAGG + Intergenic
1182525488 22:30915062-30915084 TCACCACATTAACAAATTAAAGG + Intergenic
1183478092 22:38047047-38047069 TTATCACATTAATAAATTAAGGG + Intergenic
1184305329 22:43595966-43595988 ACATCACATCAACAGAATAAAGG + Intronic
950780917 3:15390906-15390928 AAGTCACATGAACAGATTGAAGG + Intronic
951344538 3:21531085-21531107 TCATCACATTAACAGATTCCTGG - Intronic
951396392 3:22172710-22172732 TAATCAAAGCAACATATTATTGG + Intronic
951439588 3:22707563-22707585 TAATGCCATCAACAGATTCTTGG + Intergenic
951956670 3:28263234-28263256 CAAGCAAATCACCAGATTAAAGG - Intronic
952118185 3:30209497-30209519 TATGCCCATCAACAGATGAATGG + Intergenic
952250884 3:31652550-31652572 ACATCACATCAACAGAATGAAGG + Intergenic
952327150 3:32331637-32331659 AATGCACATCAACAGATTAATGG + Intronic
952549025 3:34455110-34455132 ATATCACATCAACAGAATGAAGG - Intergenic
952586201 3:34895439-34895461 TAATGCCATCAAAGGATTAAAGG + Intergenic
952604518 3:35128765-35128787 TCACCACATTAACAGATTAAAGG + Intergenic
952872611 3:37914601-37914623 TCATCATATTAACAGAATAAAGG - Intronic
953220335 3:40964999-40965021 ACATCACATCAACAGAATAAAGG - Intergenic
953422697 3:42766776-42766798 CTATCACATCAACAGGCTAAAGG + Intronic
953803265 3:46045484-46045506 CCATCACATCAGCAGAGTAAAGG + Intergenic
954517655 3:51193188-51193210 ACATCAAATCAACAGAATAAAGG - Intronic
954726074 3:52611899-52611921 TAATTTCTTCAACAGATAAATGG + Intronic
954778050 3:53037541-53037563 TAATTACATTAAGAGATCAAGGG + Intronic
954910475 3:54102870-54102892 TCACCACATTAACAGAATAAAGG - Intergenic
955249595 3:57265967-57265989 ACATCACATCAACAGAATAAAGG - Intronic
956802674 3:72775762-72775784 TCATTACATTAACAAATTAAAGG + Intronic
956912857 3:73838248-73838270 AAGTCACATCAACAGAATGAAGG + Intergenic
957178113 3:76839437-76839459 ACATCACATCAACAGAATGAAGG - Intronic
957300342 3:78384130-78384152 TATTCACATCTACAGATGAAAGG + Intergenic
957822535 3:85397480-85397502 AATACCCATCAACAGATTAATGG + Intronic
957941500 3:87011069-87011091 ACATCACATCAACAGAATCAAGG - Intergenic
958003408 3:87780639-87780661 TTATCACATTAACAGAATGAAGG + Intergenic
958686294 3:97401188-97401210 CTATCACATCAACAGAATGAAGG - Intronic
958721985 3:97855116-97855138 ACATCACATCAACAGAATGAAGG - Intronic
958872906 3:99582161-99582183 ACATCACATCAACAAAATAAAGG + Intergenic
958911682 3:100001244-100001266 TATTTACAAAAACAGATTAAGGG - Intronic
959042209 3:101435139-101435161 TCATCATATCAACAGAATGAAGG + Intronic
959218629 3:103484866-103484888 TAAATACATCAACAGTTGAAAGG + Intergenic
959277897 3:104300320-104300342 AAATGTCATCAACAGATGAATGG + Intergenic
959278058 3:104303202-104303224 ACATCACATCAACAGAATAAAGG - Intergenic
960222674 3:115132840-115132862 TTATTACATCATCAAATTAAAGG - Intronic
960230783 3:115224529-115224551 TCATCAAATCAGCAGACTAATGG + Intergenic
960748645 3:120919793-120919815 TAATCACATTAAAATATAAATGG - Intronic
960820539 3:121725754-121725776 TTAACACATTCACAGATTAATGG + Intronic
960893312 3:122474729-122474751 GAATCACATTAACAGAATGAAGG + Intronic
961341317 3:126222638-126222660 AAATCACCTCAACATACTAAAGG + Intergenic
961399218 3:126623565-126623587 TCATCATATTAACAGAATAAAGG + Intronic
962592098 3:136901178-136901200 TCATAACCTCAACAGAATAAAGG - Intronic
962644659 3:137424672-137424694 ACATCACATCATCAGAATAAAGG + Intergenic
962671360 3:137712037-137712059 AAACCATATCAACAGATGAATGG + Intergenic
963584533 3:147168323-147168345 TAATCACATTGACAAACTAATGG - Intergenic
963830036 3:149997250-149997272 TACACACATCAACAGAATAAAGG + Intronic
964509332 3:157433481-157433503 TTATTACATTAACAGTTTAAAGG - Intronic
964514042 3:157487777-157487799 TCACCACATTAACAGATTAAAGG + Intronic
964986551 3:162747763-162747785 ATATCATATCAACAGAATAAAGG - Intergenic
964997088 3:162895337-162895359 ACATCACATCAACAGAATGAAGG + Intergenic
965207248 3:165737590-165737612 ATATTACATCAACAGAATAAAGG + Intergenic
965321520 3:167257654-167257676 ACATCATATCAACAGAATAAAGG - Intronic
965562321 3:170073548-170073570 TCACCACATTAACAGAATAAAGG - Intronic
966275642 3:178163799-178163821 CAATCACATCAACAGGATAAAGG + Intergenic
966556680 3:181269611-181269633 TATTCACATAAACAAAGTAAAGG - Intergenic
966694329 3:182774414-182774436 ATATCACATCAACAGAATAAAGG - Intergenic
967341366 3:188402415-188402437 TCATTACATCATCAAATTAAGGG + Intronic
967341377 3:188402557-188402579 TCATTACATCACCAAATTAAGGG + Intronic
967373933 3:188780214-188780236 TAATCAGTTAATCAGATTAAAGG + Intronic
967573464 3:191060652-191060674 ACATCATATCAACAGAATAAAGG + Intergenic
967636971 3:191813385-191813407 AAATCATATCAAAAGAATAAAGG + Intergenic
967637237 3:191817348-191817370 GAAACACATCAACAGATGAATGG + Intergenic
967834878 3:193952955-193952977 ACATCACATCAACAGAATGAAGG - Intergenic
967960333 3:194916151-194916173 TAAACATATTAACAGAGTAAAGG - Intergenic
969862033 4:10044655-10044677 GATTCCCATCAACAGATGAATGG + Intronic
970956335 4:21816175-21816197 TAATGACATCACCAGAAGAAGGG + Intronic
971461194 4:26899206-26899228 AATTCACATTAACAGGTTAAAGG - Intronic
971819704 4:31535684-31535706 TTATCACATTAACAGAATTAAGG - Intergenic
971899269 4:32637428-32637450 TAATTATATCAACAGAATTAGGG + Intergenic
972040360 4:34587885-34587907 TAATCAAAACAACACATTATTGG + Intergenic
972271943 4:37520033-37520055 ACATCACATCAACAGAATGAAGG - Intronic
972909958 4:43802465-43802487 ACATCATATCAACAGAATAAAGG + Intergenic
972959572 4:44436109-44436131 CACTCACATCAACTGATTAGTGG + Intronic
973126987 4:46598643-46598665 ACATCATATCAACAGAATAAAGG + Intergenic
973607908 4:52606042-52606064 TAATCAAATGAACAGAGGAATGG - Intronic
973676668 4:53270233-53270255 TCACCACATTAACAGATTAAGGG + Intronic
973869841 4:55155250-55155272 TGGTAACATCAAAAGATTAAAGG - Intergenic
974257657 4:59481848-59481870 ACATCACATTAACAGACTAAAGG + Intergenic
974400653 4:61401879-61401901 TGACCTCTTCAACAGATTAATGG - Intronic
974525134 4:63041429-63041451 TCACCACATCAACAGGCTAAAGG - Intergenic
974601024 4:64079581-64079603 AAATCACATAATCAGATGAAGGG - Intergenic
974622692 4:64381664-64381686 ATATCATATCAACAGATTGAAGG - Intronic
975226358 4:71876918-71876940 ACATCACATCAACAGAATGAAGG - Intergenic
975358285 4:73434079-73434101 TCATCTCATCAAAAGATTAGAGG - Intronic
975388208 4:73783889-73783911 ACATCACATCAACAGAATCAAGG + Intergenic
975532076 4:75410690-75410712 TCATCACATCAACAGAATGAAGG - Intergenic
975884353 4:78946529-78946551 TAATCAAAACAACAGGGTAACGG - Intergenic
976073277 4:81267058-81267080 ATATCACATCAACAGAATGAAGG - Intergenic
976909654 4:90285907-90285929 AAATCACATCAACAGAATGAAGG - Intronic
976963457 4:91007047-91007069 TCATCACATTAACAGAATAAAGG - Intronic
977060121 4:92248245-92248267 GCATTACATCAACAGAATAAAGG - Intergenic
977325870 4:95573851-95573873 AAATCACATCAACAGTATGAAGG - Intergenic
977341844 4:95768810-95768832 ACATCATATCAACAGAATAAAGG + Intergenic
977376504 4:96211956-96211978 GAATGAGATCAACAGAGTAATGG + Intergenic
977603039 4:98954861-98954883 TAATCACAGCAACAGTATTAAGG + Intergenic
977783002 4:101000780-101000802 AAATGAAATCAACAGATTTAAGG - Intergenic
978326870 4:107568043-107568065 AGATCTCATCAACAGAGTAAAGG + Intergenic
978556641 4:109988237-109988259 TAGTCAAATGAATAGATTAATGG + Intronic
978775369 4:112500354-112500376 CATTCACATCAACAGGTGAATGG + Intergenic
979138338 4:117139453-117139475 ACATCACATCAACAGAATAAAGG + Intergenic
979141941 4:117187338-117187360 GAATCACAGGAACAGAATAATGG - Intergenic
979542083 4:121896041-121896063 ACATCACATCAACAGAATGAAGG + Intronic
979736241 4:124089202-124089224 TAATCACAAAAACAGTATAAAGG - Intergenic
979964339 4:127060014-127060036 ATATCACATCAACAGAATAAAGG + Intergenic
980163547 4:129197186-129197208 TTACCACATCAACAGAATAAAGG - Intergenic
980324234 4:131321102-131321124 ACATCACATTAACAGAATAAGGG + Intergenic
980432620 4:132724136-132724158 TCATCACATCAACAAATTAAAGG - Intergenic
980440816 4:132842281-132842303 ACATCACTTCAACAGAGTAAAGG + Intergenic
980570014 4:134602125-134602147 CATTCCCATCAATAGATTAATGG + Intergenic
980825598 4:138068649-138068671 ACATCACATCAACAGAATGAAGG + Intergenic
981251262 4:142604096-142604118 ATATAACATCAACAGAATAAAGG + Intronic
981336019 4:143569749-143569771 TAAGCACATCAACAAATCACAGG + Intergenic
981444127 4:144815547-144815569 ACATCACATCAACAGAATAAAGG + Intergenic
981798050 4:148621048-148621070 TTATCACATTAACAGAATAAGGG + Intergenic
982335349 4:154230846-154230868 TATTCACATAAACAAATAAATGG - Intergenic
982901454 4:161009332-161009354 AAATAAGATCAACAAATTAAAGG - Intergenic
982981217 4:162138342-162138364 TTACCACATTTACAGATTAAAGG + Intronic
983150909 4:164280002-164280024 TTATCACATCAAAAACTTAAAGG + Intronic
983158915 4:164385349-164385371 TAATAACAACAACAATTTAAAGG + Intergenic
983473867 4:168191023-168191045 AAATCACATCAACAGAATGAAGG + Intergenic
984068415 4:175080107-175080129 GCATCACATCAACAGAATGAAGG - Intergenic
984546909 4:181115976-181115998 CAAACACATTAACAGATAAAAGG - Intergenic
984622127 4:181965765-181965787 GAATCTCATCAACAGATAACTGG - Intergenic
984998186 4:185457122-185457144 TTACCATATTAACAGATTAAAGG + Intronic
985332392 4:188852502-188852524 ATATCACATCAATAGAATAAAGG + Intergenic
985751388 5:1679533-1679555 ATATCACATCAACAGAATAAAGG - Intergenic
985919039 5:2953208-2953230 ACATCACATCAACAGAATGAAGG - Intergenic
986700207 5:10399845-10399867 TAATCCCAGCAACAAATCAATGG - Intronic
986859947 5:11915370-11915392 TCACCACATTAACAGAATAAAGG + Intergenic
987152084 5:15052820-15052842 ATATCACATCAACAGAATGAAGG - Intergenic
987496812 5:18656296-18656318 CTACCACATCAACAGACTAAAGG + Intergenic
987799002 5:22668669-22668691 TGCTCACATTCACAGATTAATGG - Intronic
987895408 5:23939744-23939766 ACATCATATCAACAGAATAAAGG - Intergenic
988341171 5:29973687-29973709 ATATCACATCAACAGAATTAAGG - Intergenic
988607958 5:32697252-32697274 ACATCACATCAACAGAATGAAGG - Intronic
988861063 5:35279728-35279750 ACATCACATTAACAGAATAAGGG + Intergenic
989330166 5:40248653-40248675 ACATCACATCAACAGAATAAAGG + Intergenic
989498335 5:42136051-42136073 ACATCACATCAACAGAATGAAGG + Intergenic
989663696 5:43826196-43826218 TTATCTCATCAATAGAATAAAGG - Intergenic
989979339 5:50624128-50624150 TCATCACATTAACAAGTTAAAGG - Intergenic
990241867 5:53824074-53824096 TAATTAGACCAACACATTAAAGG + Intergenic
990577954 5:57141617-57141639 ACATCATATCAACAGAATAAAGG - Intergenic
990725994 5:58755327-58755349 AAAACAGATCACCAGATTAAAGG - Intronic
991233218 5:64361387-64361409 TTATCACATTAACAGATTAAAGG + Intronic
992186951 5:74253103-74253125 ATATCACATCAACAGAATGAAGG + Intergenic
992578953 5:78151626-78151648 TCATCATATCAACAGAATGAGGG - Intronic
993138635 5:84002149-84002171 GCATCATATCAACAGATTGAAGG + Intronic
993170918 5:84417941-84417963 AAATCATATCAACAGAATGAAGG - Intergenic
993269148 5:85770869-85770891 TCATCATATTTACAGATTAAAGG - Intergenic
993486383 5:88492086-88492108 TAATGACAGCAATAGATAAAAGG - Intergenic
993585441 5:89721688-89721710 TAAAAACAACAACAAATTAAAGG - Intergenic
993776224 5:92000725-92000747 CAATAAAAACAACAGATTAACGG - Intergenic
994229057 5:97292190-97292212 ACATCACATCAACAGAATGAAGG - Intergenic
994476926 5:100282979-100283001 CAAGGACCTCAACAGATTAAAGG - Intergenic
994771451 5:103987004-103987026 TAATGAAATCAAGAGAATAATGG - Intergenic
995109808 5:108416743-108416765 TAAGCTCCTCAACAGACTAATGG + Intergenic
995147408 5:108802107-108802129 GAAGCAAAACAACAGATTAAGGG + Intronic
995533520 5:113113696-113113718 CAATCAGATCATCAGATTGAGGG + Intronic
995733866 5:115276408-115276430 GAATCAAAGCAACAAATTAAAGG - Intronic
996258768 5:121439789-121439811 ACATCATATCAACAGAATAAAGG - Intergenic
996473815 5:123892004-123892026 ACATCACATCAACAGAATCAAGG + Intergenic
996828754 5:127716161-127716183 TCATTACATCAACAGAATGAAGG - Intergenic
997124139 5:131208973-131208995 AAATATCATCAACAGATGAAGGG + Intergenic
997188681 5:131908300-131908322 ACATCATATCAACAGAATAAAGG + Intronic
997515031 5:134482008-134482030 TTATCATATTAACAGATTAAAGG + Intergenic
997620674 5:135290676-135290698 TTACCACATTAACAGAATAAAGG - Intronic
997785330 5:136706011-136706033 ACATCACATCAACAGAATGAAGG + Intergenic
997802415 5:136878567-136878589 ACATCACATAAACAGATTTAAGG + Intergenic
997896599 5:137724052-137724074 TCATCACATTACAAGATTAAAGG - Intronic
998679469 5:144450548-144450570 AATGCCCATCAACAGATTAATGG + Intronic
998818652 5:146038048-146038070 TTATCACATTAACAGATTAAAGG + Intronic
998873003 5:146571300-146571322 TAATCACATAAACAGAACTAAGG - Intergenic
999072163 5:148755852-148755874 ACATCACATTAACAGAATAAAGG - Intergenic
999340818 5:150770010-150770032 ATATCACATCAATAGAATAAAGG - Intergenic
999413701 5:151376266-151376288 TTATCACATAAACAGAATTAAGG - Intergenic
999485142 5:151987971-151987993 AAATCACATCAATAGAATGAAGG - Intergenic
999560350 5:152794585-152794607 GCATCATATCAACAGAATAAAGG + Intergenic
999591080 5:153147168-153147190 AAACTACATCAACAGAATAAAGG + Intergenic
999863605 5:155677357-155677379 GCATCACATCAACAGAATGAAGG - Intergenic
999900783 5:156084839-156084861 AAATCACTTCAACTGATAAAAGG - Intronic
999985167 5:156996708-156996730 ACATCACATCAACAGAATGAAGG - Intergenic
1000499232 5:162027884-162027906 GCATCACATTAACAGAATAAAGG + Intergenic
1000818441 5:165954135-165954157 TAATCATAATAACTGATTAAAGG + Intergenic
1000928652 5:167225436-167225458 ACATCACATCAACAGAATGAAGG - Intergenic
1001177964 5:169490280-169490302 ACATCACATCAACAGAATGAAGG + Intergenic
1001323589 5:170702713-170702735 TAATCACATCATCTGCTTGATGG - Intronic
1001364915 5:171127193-171127215 ACATCACATCAACAGAATGAAGG + Intronic
1002090700 5:176804013-176804035 TAATCACATCTACTGCATAACGG + Intergenic
1002403467 5:179008608-179008630 TCACCGCATTAACAGATTAAAGG + Intergenic
1002550593 5:179987739-179987761 GTTTCACATCAACAGAATAAAGG - Intronic
1003001610 6:2340499-2340521 TTATTACATCAATAGAATAAAGG + Intergenic
1003156364 6:3599349-3599371 ACATCATATCAACAGAATAAAGG - Intergenic
1003744400 6:8983389-8983411 TAATCCTGTCAACAGATTACTGG - Intergenic
1003903820 6:10680283-10680305 TTATCCCATCAACAGAATGAAGG - Intronic
1004823291 6:19393283-19393305 TACTCCCATCAACAGTCTAAAGG + Intergenic
1005640307 6:27789707-27789729 TAAGCTCATCAACAGCCTAATGG + Intergenic
1007120292 6:39374963-39374985 TCAACCCATCAACAGATGAATGG + Intronic
1007157202 6:39757032-39757054 CAATCATATCAAAAGATAAAGGG - Intergenic
1007997028 6:46318603-46318625 TAACTACATCAAGGGATTAAGGG - Intronic
1008018138 6:46544684-46544706 AAATCATATCAACAGAATGAAGG + Intergenic
1008044419 6:46837212-46837234 CAATCACATAAACAAATTAACGG - Intronic
1008227033 6:48933281-48933303 ACATCATATCAACAGAATAAAGG - Intergenic
1008526227 6:52409838-52409860 CAATCCCATCAAAAGATAAAAGG - Intergenic
1009644868 6:66387331-66387353 TAAATACATAAACAAATTAATGG + Intergenic
1009708111 6:67281744-67281766 AAAGCCCATCAACAGATTAATGG + Intergenic
1009873593 6:69477956-69477978 CAATCACATCAACAGCCTAAAGG + Intergenic
1009963521 6:70553265-70553287 TAAACAAATCAACAGGTTAAAGG - Intronic
1010035130 6:71317044-71317066 TAATAACATTTACAGATGAATGG + Intergenic
1010268017 6:73889444-73889466 AATTCCCATCTACAGATTAATGG - Intergenic
1010293000 6:74161387-74161409 TAATCACATTAATAGAATGAAGG + Intergenic
1010598599 6:77796100-77796122 TAACCACATTAACAGAATGAAGG + Intronic
1010674792 6:78729762-78729784 TCATTACATTAACAGATGAAAGG - Intergenic
1011024313 6:82850045-82850067 ACATCATATCAACAGAATAAAGG + Intergenic
1011103651 6:83754147-83754169 ACATCACATCAACAGAATCAAGG - Intergenic
1011151176 6:84275147-84275169 TAATCACTTCAACAGGTCAAAGG + Intergenic
1011300807 6:85871309-85871331 TAATCACATCAACAAAAAGAAGG - Intergenic
1011446137 6:87442752-87442774 TCACCACATTAGCAGATTAAAGG - Intronic
1011758146 6:90527130-90527152 TAATCACATCAACAGATTAAAGG + Intronic
1011804544 6:91057005-91057027 TCATCACATCAACAGAGTGAAGG - Intergenic
1011969598 6:93206379-93206401 ACATCACATCAGCAGAATAAAGG + Intergenic
1012303108 6:97614505-97614527 ACATCACATCAACAGAATGAAGG - Intergenic
1012717477 6:102694810-102694832 ATATCATATCAACAGAATAAAGG - Intergenic
1012796009 6:103762147-103762169 GCATCACATTAACAGAATAAAGG + Intergenic
1013452093 6:110292945-110292967 TGAACAGATAAACAGATTAATGG - Intronic
1013568574 6:111395960-111395982 ACATCACATCAACAGAATGAAGG - Intronic
1013997956 6:116330991-116331013 TTATGACATTAACAGAATAAAGG + Intronic
1014073491 6:117210509-117210531 ACATCATATCAACAGAATAAAGG - Intergenic
1014163889 6:118201809-118201831 TAAGCACATGGACAGATTAGTGG - Intronic
1014355335 6:120401790-120401812 ACATCATATCAACAGAATAAAGG - Intergenic
1014393025 6:120888607-120888629 TAATTACACCAGCAGACTAAAGG - Intergenic
1014410331 6:121109679-121109701 TAATTAAATCAATACATTAAAGG + Intronic
1014447549 6:121546379-121546401 TTGGCACATTAACAGATTAAAGG + Intergenic
1014589750 6:123249086-123249108 ACATCACATCAACAGATTGAAGG + Intronic
1014840471 6:126214012-126214034 TCATCATATCAACAGAATGAAGG - Intergenic
1015013368 6:128378437-128378459 AAATGACATCAAAAGATTGATGG + Intronic
1015297317 6:131611158-131611180 TAATCACATCTAAAGTTTAGGGG - Intronic
1015837803 6:137440579-137440601 ATATCACATCAACAGAATGAAGG - Intergenic
1016457083 6:144242585-144242607 ATATCATATCAACAGAATAAAGG - Intergenic
1016643172 6:146374133-146374155 ACATCATATCAACAGAATAAAGG - Intronic
1016776394 6:147909244-147909266 TAAACACATTCACAGATTGATGG - Intergenic
1016948615 6:149558249-149558271 ACATCACATCAACAGAATGAAGG + Intergenic
1017148472 6:151256251-151256273 TAATAATATTAACATATTAAGGG - Intronic
1017318993 6:153066715-153066737 ATATCACATCAACAGAATGAAGG + Intronic
1017579301 6:155844694-155844716 AAATCATATCAACAGAATGAAGG + Intergenic
1017840557 6:158218831-158218853 TAAACAAATTAACAGATGAATGG - Intergenic
1017974364 6:159342543-159342565 ATATCACATCAACAGAATGAAGG + Intergenic
1018043874 6:159949282-159949304 AACTCACAAAAACAGATTAATGG - Intergenic
1018074081 6:160195029-160195051 AAATCACATCAACAGAATGAAGG + Intronic
1018408327 6:163512065-163512087 TAATCATAACAATAGAATAAAGG + Intronic
1018448549 6:163882403-163882425 ACATCACATCAACAGAATAAAGG + Intergenic
1019090161 6:169523657-169523679 ACATCACATCAACAGAATTAAGG + Intronic
1019233782 6:170591118-170591140 TAATCAAATGAAAAGCTTAATGG - Intergenic
1020761729 7:12275764-12275786 ACATCACATCAACAGAATGAAGG - Intergenic
1020780577 7:12512460-12512482 ACATCACATCAACAGAATGAAGG - Intergenic
1021250541 7:18320197-18320219 TAATCTCATAAGCAGATAAAAGG - Intronic
1021339637 7:19448576-19448598 ACATCACATAAACAGAATAAAGG - Intergenic
1021369290 7:19821330-19821352 ATATCACATCAACAGAATCAAGG - Intergenic
1021534960 7:21693237-21693259 TCAGCACATTAACAGAATAAAGG - Intronic
1022986098 7:35655441-35655463 ACATCACATCAACAGAATGAAGG + Intronic
1023109826 7:36798610-36798632 CTATCACATTAACAGAATAAAGG - Intergenic
1023195262 7:37630713-37630735 ATATCATATCAACAGATTGAAGG - Intergenic
1023707993 7:42962308-42962330 TAATAACATCAATAAATGAATGG + Intergenic
1024017519 7:45331182-45331204 AAGGCCCATCAACAGATTAATGG - Intergenic
1024449197 7:49519389-49519411 TAATGTTATCAACAGATGAATGG + Intergenic
1024757085 7:52546912-52546934 TAATCAAAACAACAAAATAAAGG - Intergenic
1024758044 7:52559850-52559872 TAATCAAATCAACAAGTTAAGGG + Intergenic
1024808187 7:53174428-53174450 ATATCACATTAACAGAATAAAGG - Intergenic
1024927676 7:54634868-54634890 TAATCACATTAACAGATTAATGG - Intergenic
1026230451 7:68478760-68478782 TAAGCACATTAACTGTTTAAAGG + Intergenic
1027628426 7:80572825-80572847 ACATCACATCAACAGAATGAAGG - Intronic
1028131373 7:87178512-87178534 TAATCACATCAGCAAATTTATGG - Intronic
1028152099 7:87385952-87385974 ATATCACATCAACAGAATAAAGG - Intronic
1028158514 7:87459534-87459556 AAATCAGATTAACAGATGAATGG - Intronic
1028215198 7:88123040-88123062 TCATCACATTAACAGATTAAAGG - Intronic
1028520401 7:91724079-91724101 ATATCACATCAACAGAATGAAGG + Intronic
1028787279 7:94809917-94809939 ACATCACATCAACAGAAGAAAGG + Intergenic
1028817757 7:95166882-95166904 ACATCACATCAACAGAATGAAGG + Intronic
1028950239 7:96626557-96626579 ACATCATATCAACAGAATAAAGG - Intronic
1029021211 7:97366271-97366293 ACATCACATCAACAGAATGATGG + Intergenic
1029319191 7:99742398-99742420 TGATCTCATCAACAGATTAAAGG + Intergenic
1030184090 7:106742726-106742748 TTAACACGTCAATAGATTAAAGG - Intergenic
1030241088 7:107326147-107326169 AAATTACATCAACATAATAAGGG + Intronic
1030522578 7:110616820-110616842 AAATCATATCAACAGAATGAAGG - Intergenic
1031160760 7:118165158-118165180 TTACCACATAAACAGAATAAAGG - Intergenic
1031190472 7:118543048-118543070 ACATCACATCAACAGAATAAAGG + Intergenic
1031302111 7:120073601-120073623 ACATCACATCAACAGAATGAAGG + Intergenic
1031537299 7:122951114-122951136 TTATCAGATCAACAGATCACAGG - Intergenic
1031565316 7:123289197-123289219 ACATCACATCAACAGAGTGAAGG - Intergenic
1031666750 7:124493843-124493865 TTCTCTTATCAACAGATTAATGG - Intergenic
1031795516 7:126169172-126169194 TCATCACTTCAACAGGTCAAAGG + Intergenic
1031874675 7:127124857-127124879 TAATCAATTCACCATATTAACGG + Intronic
1032318091 7:130859779-130859801 ACATCACATCAACAGAATGAAGG + Intergenic
1032661885 7:133993022-133993044 ACATCACATCAACAGAATAAAGG - Intronic
1032678150 7:134151752-134151774 TAACTACATTAATAGATTAAAGG + Intronic
1033877177 7:145836551-145836573 ACATCATATCAACAGAATAAAGG - Intergenic
1033879719 7:145865564-145865586 ACATCACATCAACAGAATGAAGG - Intergenic
1033885980 7:145945925-145945947 AAATTATATCAACAGATTGAGGG + Intergenic
1034230432 7:149522173-149522195 TCATTACATTAACAGAATAAAGG + Intergenic
1034396534 7:150830085-150830107 ACATCACATCAACAGAATGAAGG - Intronic
1034757575 7:153637366-153637388 ACATCACATCAACAGAATAAAGG - Intergenic
1035309718 7:157958240-157958262 AAATCACCTCAACATAATAAAGG + Intronic
1035742761 8:1940840-1940862 GCATCACATTAACAGAATAATGG + Intronic
1036393040 8:8341621-8341643 TCATCACATTCACAGAGTAAAGG - Intronic
1037199096 8:16228641-16228663 TAACAAGATTAACAGATTAAAGG - Intronic
1037940357 8:22946594-22946616 TATTCACCTCCACAGTTTAATGG + Intronic
1038154406 8:24974723-24974745 TAATCACATTTACAGAATAAAGG - Intergenic
1038225164 8:25649628-25649650 ACATCACATCAACAGAATGAAGG - Intergenic
1038624923 8:29182489-29182511 TAATCACATTGACAGCCTAAGGG + Intronic
1038805091 8:30783041-30783063 AAATTCCATCAACAGATTAATGG - Intronic
1038902675 8:31861610-31861632 TCATCACATCTTCAGATTCATGG - Intronic
1039638879 8:39196606-39196628 ACATCACATCAACAGAATGAAGG - Intronic
1039651908 8:39350915-39350937 CCATCACATCAACAAAGTAAAGG + Intergenic
1039703798 8:39987371-39987393 TACACACATAAACAGATTAGAGG + Intronic
1040370222 8:46763240-46763262 TAATCAAAGCAACTGATTAATGG + Intergenic
1040450971 8:47546967-47546989 GAACCACATCAAAAGATCAAGGG + Intronic
1041079034 8:54197810-54197832 ACATCACATCAACAGGATAAAGG - Intergenic
1041199899 8:55443315-55443337 TATCCACATTAACAAATTAATGG + Intronic
1041431723 8:57789160-57789182 ACATCACATCAACAGAATGAAGG + Intergenic
1041517786 8:58720522-58720544 TAACCACATGGACAGAATAAGGG + Intergenic
1041563791 8:59251715-59251737 ACATCACATCAACAGAATAAAGG - Intergenic
1041889118 8:62848935-62848957 TCATCACATAAACAGATCTAAGG - Intronic
1042129634 8:65574817-65574839 ACATCACATCAACAGAATCAAGG - Intergenic
1042173558 8:66016339-66016361 TTATCACAACAACAGCATAAGGG - Intergenic
1042181708 8:66094874-66094896 TCATCACATTAACAGATCAAAGG - Intronic
1042261439 8:66864343-66864365 ACATCACATCAACAGAATGAAGG + Intergenic
1042989127 8:74619665-74619687 TTATCACAAGAACAGAATAAGGG + Intronic
1043198093 8:77326188-77326210 ATATTACATCAACAGAGTAAAGG - Intergenic
1043515003 8:80987884-80987906 AAATCAAAACTACAGATTAAGGG + Intronic
1044232362 8:89794176-89794198 TAAACACTTCCACAGATAAAGGG + Intergenic
1044394809 8:91698652-91698674 ACATCACATCAACAGAATGAAGG - Intergenic
1044876993 8:96679194-96679216 ACATCACATCAACAGAATGAGGG - Intronic
1045157523 8:99493036-99493058 TAGTCACATTAAGAGAATAAAGG - Intronic
1045945663 8:107792878-107792900 GTATCACATCAACAGAATATAGG + Intergenic
1045991209 8:108310313-108310335 ACATCACATCAACAGAATGAAGG + Intronic
1046199708 8:110908895-110908917 CAATCACATCAAGAGTTTTAAGG - Intergenic
1046279980 8:112015391-112015413 TCATCATATCAACAGACTACAGG + Intergenic
1046404788 8:113759084-113759106 TCATGAAATCAACAGATGAAAGG - Intergenic
1046459524 8:114515061-114515083 ACATCACATCAACAGAATAAAGG + Intergenic
1046517396 8:115281052-115281074 AAATTACATCAACATAATAAAGG + Intergenic
1046837364 8:118817384-118817406 TAATCACAAGAACACATTAGTGG - Intergenic
1047564554 8:126028562-126028584 ATATCACATCAACAGAATTAAGG + Intergenic
1048646264 8:136423598-136423620 ATATCACCTCAACAGAATAAAGG + Intergenic
1048647041 8:136433348-136433370 ACATCATATCAACAGAATAAAGG + Intergenic
1049635727 8:143687934-143687956 TAACCAAATTAACAGAATAAAGG - Intronic
1050618162 9:7425013-7425035 ACATCATATCAACAGAATAAAGG - Intergenic
1050790903 9:9467792-9467814 TAACCACGTAAACTGATTAAAGG - Intronic
1050824225 9:9924383-9924405 TAATAACAGCAACAGAATAATGG - Intronic
1051275979 9:15398934-15398956 TCATCACATTAACAGAATAAAGG - Intergenic
1051457028 9:17270384-17270406 TTACCACATTAAGAGATTAAAGG - Intronic
1051997935 9:23241608-23241630 ATATCACATCAACAGAATGAAGG + Intergenic
1052002374 9:23300689-23300711 TCACCACATTAACAGAATAAAGG - Intergenic
1052258219 9:26484260-26484282 TAAGTACATCAGCAGATGAATGG - Intergenic
1052417596 9:28197748-28197770 TGATCAAATCAAAAGATAAATGG + Intronic
1052511756 9:29431120-29431142 CATTCACACCAACAGAGTAAAGG + Intergenic
1053181319 9:35972863-35972885 TTATCACATCAACAGAATGAAGG - Intergenic
1053491893 9:38513348-38513370 TAATCACATTTATAGAATAAAGG + Intergenic
1053565426 9:39244986-39245008 TAATCATATAATCATATTAAAGG + Intronic
1053653176 9:40189718-40189740 CAATCGCATAAACAAATTAACGG + Intergenic
1053903578 9:42819008-42819030 TAATCGCATAAACAAATTAACGG + Intergenic
1054131724 9:61374053-61374075 TAATCATATAATCATATTAAAGG - Intergenic
1054531408 9:66186500-66186522 TAATCACATAAACAAATTAACGG - Intergenic
1055037448 9:71833024-71833046 ACATCACATCAACAGAATGAAGG + Intergenic
1055176887 9:73329916-73329938 AAATCACATTAACAGAATGAAGG - Intergenic
1055310219 9:74971421-74971443 ACATCACATCAACAGAATGAAGG + Intergenic
1055388549 9:75792891-75792913 TCACCACATTGACAGATTAAAGG - Intergenic
1055594761 9:77853937-77853959 TCATCATATCAACAGATTTCAGG - Intronic
1056039020 9:82641334-82641356 ACATCACATCAACAGAATGAAGG + Intergenic
1057571702 9:96208819-96208841 TAATCATATTAATAGAATAAAGG - Intergenic
1057672191 9:97102568-97102590 TAATCACATTTATAGAATAAAGG + Intergenic
1057709257 9:97422803-97422825 TTACTACATCAACAGATTAAAGG - Intronic
1058511834 9:105727688-105727710 AAACCATATCAACAGATGAATGG - Intronic
1058780452 9:108328485-108328507 ACATCACATCAACAGAATGAAGG + Intergenic
1058816615 9:108688962-108688984 TCATCACATCAACAGGTCAAAGG + Intergenic
1058900820 9:109440657-109440679 TAATGAAACCAACAGAGTAAAGG - Intronic
1059030216 9:110685231-110685253 ACATCATATCAACAGATGAAGGG - Intronic
1059377414 9:113895340-113895362 TCATCACATCGGCAGATCAAAGG - Intronic
1059554925 9:115270797-115270819 ACATCATATCAACAGAATAAGGG - Intronic
1059706843 9:116832605-116832627 AAATCACATCATCATATCAATGG - Intronic
1060227746 9:121805524-121805546 AAATCTCATCAACAGATGAATGG + Intergenic
1061128973 9:128696822-128696844 TAAGCACAGTAAGAGATTAACGG - Intergenic
1061835794 9:133328694-133328716 AATTCATATCAATAGATTAAAGG - Intergenic
1061989403 9:134150307-134150329 TAATTCTACCAACAGATTAAAGG + Intronic
1062604478 9:137339628-137339650 TCATCACATTTACAGATTAAAGG + Intronic
1185715860 X:2341619-2341641 AAATCACATGTACAGATTCAAGG + Intronic
1186075934 X:5878942-5878964 GAACAACATCAACAGATGAATGG + Intronic
1186926722 X:14341513-14341535 CAAACACATCAACATCTTAAAGG + Intergenic
1188326043 X:28802221-28802243 TAATCACATCACCACATGCAAGG - Intronic
1188773773 X:34188166-34188188 TTATCATATCAACAGAATGAAGG - Intergenic
1189019925 X:37324562-37324584 GAATCATATCAACAGAATAAAGG + Intergenic
1189122953 X:38414686-38414708 TAATCTCATCAACAGGCTACAGG + Intronic
1189221116 X:39372998-39373020 AAATCACATCAACATTTTGAAGG - Intergenic
1189501469 X:41564158-41564180 TCACCACATTAACAGATAAAAGG + Intronic
1189628534 X:42925740-42925762 GCATCACATCAACAGAATAAAGG + Intergenic
1189641506 X:43077207-43077229 TCATCATATCAACAGAATGAAGG + Intergenic
1190340333 X:49290944-49290966 TCACCACATTAACAGATTAATGG - Intronic
1190558954 X:51668572-51668594 TCACCACTTGAACAGATTAAAGG + Intergenic
1190565337 X:51724750-51724772 TCACCACTTGAACAGATTAAAGG - Intergenic
1190802965 X:53809443-53809465 AAACCACATTAACAGAATAATGG + Intergenic
1190862186 X:54355647-54355669 GAATAACATAAACAGATTTATGG - Intronic
1190943156 X:55063827-55063849 AAATCATATCAACAGAATGAAGG - Intergenic
1191148464 X:57193798-57193820 TCATCATATCAACAGAATTAAGG - Intergenic
1191195922 X:57722701-57722723 TCATCACATAAACAGAAAAAAGG - Intergenic
1191658087 X:63621351-63621373 TGATGACATTAACAGTTTAAAGG + Intergenic
1191664009 X:63679575-63679597 TTACCACATTGACAGATTAAAGG + Intronic
1191814995 X:65234227-65234249 GCATCACATCAACAGAATAAGGG + Intergenic
1191949897 X:66578000-66578022 AAATCATATCAACACATTTAAGG - Intergenic
1192163908 X:68811245-68811267 AAATCATATTAACAGAATAAAGG + Intergenic
1192601689 X:72471226-72471248 AAATAACATCAACTGATGAATGG - Intronic
1192629502 X:72765613-72765635 ACATCACATCAACAGAATAAAGG - Intergenic
1192652208 X:72955201-72955223 ACATCACATCAACAGAATAAAGG + Intergenic
1192658644 X:73019926-73019948 AATTCACATCAACACAATAAAGG - Intergenic
1192742029 X:73902835-73902857 ACATCACATCAACAGAATAAAGG - Intergenic
1192894735 X:75430154-75430176 TAATCACAACAACACTTTATAGG + Intronic
1193324484 X:80163717-80163739 TATTCTCATCAACAGATGAATGG + Intergenic
1193385119 X:80860628-80860650 ACATCACATCAACAGAATGAAGG - Intergenic
1193562502 X:83036478-83036500 ATATCACATCAACAGAATAAAGG + Intergenic
1193646262 X:84072273-84072295 ACATCACATCAACAGAATCAAGG + Intronic
1193869032 X:86774332-86774354 TAATTATTTCAACAGATGAAAGG - Intronic
1193987345 X:88260209-88260231 TATACACATAAAAAGATTAATGG - Intergenic
1194005429 X:88485709-88485731 ATATCACATCAACAGAATGAAGG - Intergenic
1194190616 X:90832392-90832414 TAATCACATCTACAAAATATGGG + Intergenic
1194338411 X:92678556-92678578 GCATCATATCAACAGAATAAAGG - Intergenic
1194441084 X:93935282-93935304 TTATGTCATCAACAGATGAATGG + Intergenic
1194500038 X:94671665-94671687 ACATCATATCAACAGAATAAAGG - Intergenic
1194652642 X:96533782-96533804 TGCTGACATCAACAGATGAATGG + Intergenic
1194793500 X:98180837-98180859 TAATCACATTCACATTTTAAAGG - Intergenic
1194896137 X:99442626-99442648 TAATCATGTCAGCAGATTGAAGG + Intergenic
1195592302 X:106643691-106643713 ATATCATATCAACAGATTAAAGG - Intronic
1195595794 X:106687631-106687653 ACATCATATCAACAGAATAAAGG + Intergenic
1195650895 X:107283111-107283133 ACATCACATCAACAGAATGAAGG + Intergenic
1195780403 X:108456868-108456890 TAATCACACTAAGTGATTAAAGG - Intronic
1195786713 X:108532298-108532320 ACATTACATCAACAGATTGAAGG + Intronic
1195881377 X:109596212-109596234 TCATTACATCCACATATTAAAGG + Intergenic
1195985436 X:110625531-110625553 ACATCACATCAACAGAATAAAGG + Intergenic
1196226022 X:113167825-113167847 TTATCTTATTAACAGATTAAAGG - Intergenic
1196245828 X:113398865-113398887 TTACTACATCAACAGATTAAAGG - Intergenic
1196264395 X:113625396-113625418 TCATCATATCAACAGAATGAAGG - Intergenic
1197308977 X:124880805-124880827 ACATCACATCAACAGAATGAAGG - Intronic
1197341255 X:125268502-125268524 ACATCATATCAACAGAATAAAGG - Intergenic
1197391599 X:125873829-125873851 ACATCATATCAACAGAATAAAGG - Intergenic
1197554814 X:127939992-127940014 GCATCATATCAACAGATTGAAGG - Intergenic
1197677996 X:129351566-129351588 TCATCATATCAACAGAATTAAGG + Intergenic
1198294064 X:135267984-135268006 ACATCACATCAACAGAATGAAGG + Intronic
1198584159 X:138100978-138101000 ACATCACATCAACAGAAGAAGGG + Intergenic
1198925344 X:141785639-141785661 CCATCATATCAACAGAATAAAGG - Intergenic
1199174890 X:144775838-144775860 AAGTCCCATCAACAGATGAATGG - Intergenic
1199317456 X:146396907-146396929 GCATCACATCAACAGAATATAGG - Intergenic
1199323220 X:146465777-146465799 ACATCACATCAACAGAATAAAGG + Intergenic
1199910012 X:152276018-152276040 TAATAACATTAACATATTAGAGG + Intronic
1199922289 X:152419993-152420015 TCATCATATTAACAGAATAAAGG + Intronic
1200031350 X:153298517-153298539 ACAACACATCAACAGAATAAAGG + Intergenic
1200270911 X:154682582-154682604 CAAGCACATTAACAGATTAAAGG - Intronic
1200273062 X:154705455-154705477 ACATCACATCAACAGAATCAAGG + Intronic
1200327230 X:155253690-155253712 TAATTACATTCACAGGTTAAGGG + Intergenic
1200334059 X:155329789-155329811 ATATCCCATCAACAGATGAATGG + Intronic
1200419105 Y:2944421-2944443 TAAGCACATTAATAAATTAAAGG - Intronic
1200646813 Y:5795339-5795361 GCATCATATCAACAGAATAAAGG - Intergenic
1201690280 Y:16756313-16756335 TTAACACATCAAGTGATTAATGG + Intergenic
1201984089 Y:19944190-19944212 ATATCACATCAACAGAATAAAGG - Intergenic
1202056583 Y:20839564-20839586 ATATCACATCAACAGAATAAAGG - Intergenic