ID: 1011758553

View in Genome Browser
Species Human (GRCh38)
Location 6:90532083-90532105
Sequence AAGGAGGTGCAGAATGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 673}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011758550_1011758553 -2 Left 1011758550 6:90532062-90532084 CCAGAACATTTGTTTACACAAAA 0: 1
1: 0
2: 2
3: 27
4: 334
Right 1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG 0: 1
1: 0
2: 4
3: 73
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011758553 Original CRISPR AAGGAGGTGCAGAATGAAGA TGG Intronic
900471997 1:2859602-2859624 AAGGAGGGGTAGGAGGAAGAAGG + Intergenic
900830163 1:4959988-4960010 AAGGAGGTGGAGAGGGAAGAGGG + Intergenic
900850011 1:5135401-5135423 CAGGAGGTGAATAATGAGGAGGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901374231 1:8826088-8826110 AGGGAGGTGCAAATAGAAGAAGG - Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
901785601 1:11622541-11622563 TAGGAGGTGCAGAGTGGAGAAGG - Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902978906 1:20109293-20109315 AAGGATGTGGGGAATGAACATGG + Intergenic
903207640 1:21794950-21794972 AAGGAGGTGGAGAATCAAGAGGG - Intergenic
903769958 1:25757527-25757549 AAGAAGGTGCAGAATGGGGGTGG - Intronic
904195455 1:28782068-28782090 AAGGAGGTGAAGAAGTAAGTGGG - Intergenic
904260851 1:29286863-29286885 AAGGAGGTCCAGAGTGATGGGGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
904818347 1:33221967-33221989 AAGCAGGTGGAGGAGGAAGAGGG + Intergenic
905104517 1:35556834-35556856 AAGTTGGTGCAGAATGAAGAGGG - Intronic
905157784 1:36001840-36001862 GAGGAGGTTCAGACTGGAGAGGG + Intronic
905242912 1:36592701-36592723 ACGGAGGTCCAGACAGAAGATGG + Intergenic
905929752 1:41778809-41778831 AAGGAGATGGAGCATGATGAGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
906804154 1:48763863-48763885 CAGGAGGGGCAGGATGAACAGGG + Intronic
907703768 1:56815216-56815238 AAGGAGGGGGAGAAGGCAGAAGG - Intronic
907903425 1:58762457-58762479 AAGGTGATGCAGGATGAAGCTGG + Intergenic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
907968005 1:59352226-59352248 AACAAGGTGCAGACTGAGGAAGG + Intronic
908091975 1:60695922-60695944 AAGGAGGAGCAGAGTAAAGGAGG + Intergenic
908882229 1:68745036-68745058 GAGCTGGTGCAGGATGAAGAAGG + Intergenic
909437692 1:75662361-75662383 AGGGAGCTGGAGTATGAAGAGGG + Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
909991035 1:82222716-82222738 AATGAGGAGCAGAATGGAGCTGG - Intergenic
910074479 1:83261222-83261244 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
910287256 1:85569593-85569615 AAGGAGGTGGAGGACGAAGATGG - Intronic
910320404 1:85937166-85937188 ACGTAGGTGCAAACTGAAGATGG + Intronic
910590282 1:88922747-88922769 AAGAAGGGTCAGAATAAAGATGG - Intergenic
910591704 1:88933360-88933382 AAGGAGGAGAAGAAGGAAAAAGG + Intergenic
910820218 1:91337860-91337882 AAGGAGGAGGAGAACCAAGAGGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912158534 1:106952270-106952292 AAGGAGGGTAAGAAAGAAGAAGG + Intergenic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912932369 1:113976016-113976038 AAGGAGGTGCAGGATGGAGATGG + Exonic
913153141 1:116065654-116065676 AAGGAGGTGGAAAAGGGAGAAGG - Intronic
913373797 1:118129663-118129685 AAGAAGGTAGAGAAAGAAGAAGG - Intronic
914973133 1:152329717-152329739 AAGGAGGTAAAGGATGTAGAAGG + Intergenic
915129861 1:153688663-153688685 AAGGAGGTGGAGAATGACAAGGG - Intronic
915269983 1:154747038-154747060 TAGGAGGTGCAGGAGGAAGAGGG - Intronic
915478856 1:156171373-156171395 AAGGAGGCTCAGAATGGAGAAGG + Intronic
915535554 1:156533425-156533447 GAGGAAGGACAGAATGAAGATGG - Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
916486440 1:165263952-165263974 ATGGTAGTGCTGAATGAAGAAGG + Intronic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
917260807 1:173166039-173166061 AAGGATGTGAAGAAAGGAGATGG - Intergenic
917261532 1:173174591-173174613 CAAGAAGTGCAGAATGAAGGGGG + Intergenic
918131897 1:181636969-181636991 ATGGGGGTGCATATTGAAGAGGG - Intronic
918389955 1:184049115-184049137 AAAGAGTTGAAGAATGAAAAGGG - Intergenic
918748212 1:188234175-188234197 AAGGAGTAGGAGAATAAAGACGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920528259 1:206684640-206684662 AAGGAGCTGCATAATTCAGATGG - Intergenic
920716335 1:208343806-208343828 AAGGAGGCACAGGATGGAGATGG - Intergenic
920885227 1:209921004-209921026 AAGGAGTTTCAGAAAGAAAAAGG - Intergenic
921254033 1:213323366-213323388 AGGCAGGTGCAGGATGAAGGTGG + Intergenic
921283657 1:213590310-213590332 AAGGAGGTCCTGGATGAAGGTGG + Intergenic
921347993 1:214206847-214206869 AAGGAGGTGCAGCCAAAAGATGG + Intergenic
921658448 1:217769259-217769281 AATGTGTTCCAGAATGAAGATGG + Intronic
921739186 1:218664472-218664494 GAGGAGGTGGAGGAGGAAGAAGG - Intergenic
922209486 1:223476670-223476692 AAGGAGGAGAAGGAGGAAGATGG + Intergenic
922781928 1:228259539-228259561 AGGGAGGTGCAGGCTGAAGCAGG + Exonic
922818531 1:228468775-228468797 AAGGAAGTAAAGAAAGAAGAGGG + Intergenic
923558571 1:235021325-235021347 AAGGGGGTCCAGTCTGAAGAAGG + Intergenic
923945823 1:238886229-238886251 ACCGAGGGGCAGAATGCAGAAGG + Intergenic
924120372 1:240791310-240791332 AATATGGTGCACAATGAAGAGGG + Intronic
1062781121 10:208769-208791 AATGAGGTGGAGAAGGAAGAAGG + Intronic
1062800683 10:377327-377349 AAGGAGGTGCAGCGGGAAGATGG - Intronic
1062971141 10:1650429-1650451 AAGGGGGTGGAGAATGGAGGTGG + Intronic
1063525256 10:6778871-6778893 AGGGAGGGAGAGAATGAAGAAGG + Intergenic
1063697973 10:8356325-8356347 AAGGAGGGAAAGAATGAAGGAGG - Intergenic
1063728101 10:8662324-8662346 AAAGAGCTGCAGAATAAAGTAGG + Intergenic
1063916065 10:10883905-10883927 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1065876220 10:29999715-29999737 AAGGAGGTGCACACTGGAAAAGG - Intergenic
1065908118 10:30277636-30277658 AAGGATGTGAAGAAATAAGAAGG + Intergenic
1065992397 10:31025180-31025202 AAGGAGGAACAGAAGGAAGGAGG + Intronic
1066261918 10:33737619-33737641 AAGGAGGTGCAGGGAGAACAAGG + Intergenic
1067358183 10:45550697-45550719 AAGGTGGGACAGAATGAACAAGG - Intronic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067837759 10:49652145-49652167 AAGGAGGAGCAGACTGAACTGGG + Intronic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067949675 10:50720750-50720772 CAGGAGATGCTGAATAAAGATGG - Intergenic
1069599306 10:69693122-69693144 AAGGAGTTGCAGAAGGTAAAGGG - Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070098003 10:73357298-73357320 AAGGAAGTGCTGAATGAAGCTGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070884983 10:79885790-79885812 CAGGAGATGCTGAATAAAGATGG - Intergenic
1070906334 10:80076759-80076781 AAGGAGGAGAAGAATAAAGAGGG + Intergenic
1071128979 10:82369959-82369981 AAGGAGGGGAAGCATGCAGAAGG + Intronic
1071168522 10:82834924-82834946 AAGGAGGACCAGATTGAAAATGG - Intronic
1071605234 10:86981251-86981273 AGAGAAGTGCAGAATGAAGAGGG - Intronic
1071785412 10:88894139-88894161 AAGGAGGTTGATAATGAATAGGG - Intronic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1072195340 10:93113072-93113094 AAAGAGGTGCAGAATCCAGGAGG + Intergenic
1072727919 10:97825953-97825975 GAGGAGGTGCACGATGCAGAGGG - Intergenic
1072861264 10:99007436-99007458 AAGAAGGGGCACATTGAAGAGGG - Intronic
1073811084 10:107152620-107152642 AGAGAGGTGCAGAGTGAAGTGGG - Intronic
1074233017 10:111556396-111556418 AAGGAGGTGCATACTGTAGTGGG + Intergenic
1074284772 10:112088023-112088045 AAGGACGTGGAGGAAGAAGAGGG - Intergenic
1075688041 10:124377533-124377555 AGGGAGGTGGGGAAAGAAGATGG + Intergenic
1075812343 10:125233667-125233689 AAGGAGGTGAAGAAGGAATCCGG - Intergenic
1076001500 10:126916702-126916724 AAGGAGGGGTAGAAGGAAGGAGG - Intronic
1076201470 10:128562194-128562216 AAAAACTTGCAGAATGAAGAAGG - Intergenic
1076358825 10:129872217-129872239 AATGAGGTTCACAATTAAGAAGG - Intronic
1076986246 11:237651-237673 AACCAGCTGCAGAATGAATAGGG - Intronic
1077042908 11:532466-532488 AAGGAGGTGCAGACGGAAGGAGG - Exonic
1078065836 11:8079020-8079042 AGTGAGGTGCAGAAGTAAGATGG - Intronic
1078168227 11:8909423-8909445 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1078566496 11:12418646-12418668 AATGGGGAGCAGAATAAAGATGG - Intronic
1078682747 11:13494344-13494366 TAGGAAGTACATAATGAAGAGGG - Intronic
1079810950 11:24999372-24999394 AAGGAGGAGGAGCAGGAAGATGG + Intronic
1079810962 11:24999418-24999440 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1080556795 11:33424865-33424887 GAGGAGGTGAAGAATGAGGTTGG + Intergenic
1080738884 11:35045199-35045221 AAGAAGGTGCTGAAAGAGGATGG + Intergenic
1081574956 11:44313305-44313327 ATGGAGGTGGAGAAAGAAGCGGG - Intergenic
1082788079 11:57328280-57328302 GTGGAGGTGCAGACTGTAGATGG - Exonic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082929979 11:58592375-58592397 AAGGATGTGCAGACTGGACACGG - Intronic
1083380609 11:62265293-62265315 AAGGTAGTGAAGAAAGAAGATGG - Intergenic
1083929298 11:65831424-65831446 AAGAAGGTGCAGACTGAAGTGGG - Intronic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085027536 11:73245320-73245342 AAGGAGGTGATAAAAGAAGAGGG + Intergenic
1085596608 11:77816860-77816882 AAGGATGTGCCAAATGAAGGTGG - Intronic
1085680823 11:78573593-78573615 GAAGAGGTGCAGAATAAACAAGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087327282 11:96739045-96739067 GAGGTGATGCAGACTGAAGAGGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087649312 11:100846487-100846509 TAGGAGGTGGAGAAAGAATATGG - Intronic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1089517806 11:119044875-119044897 AGGGAGGGGCACAGTGAAGAAGG - Exonic
1090353102 11:126120412-126120434 AGGCAGGTACAGAATGCAGAAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1090944088 11:131414162-131414184 AAGGTGGGGCAGCATGAAGCAGG + Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091667981 12:2432901-2432923 AAGGAATTGGAGACTGAAGAGGG + Intronic
1091951849 12:4599435-4599457 CAGGAGTTGCAGAATCAATAGGG + Intronic
1092205779 12:6613623-6613645 ATGGTGGTGCAGAATGGGGAGGG - Intergenic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092584368 12:9881590-9881612 GAAGAGATGGAGAATGAAGATGG + Exonic
1093121528 12:15277037-15277059 AACCATGTGAAGAATGAAGAGGG + Intronic
1093514267 12:19967416-19967438 AAAGATGTGATGAATGAAGATGG - Intergenic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094020885 12:25913025-25913047 AAGAAGGTGGGGAATGAAGCTGG - Intergenic
1095196858 12:39329455-39329477 AAGGAGGAGAAAGATGAAGAAGG + Intronic
1095466899 12:42497194-42497216 AAGGAGGAGGAGAAAGATGAGGG + Intronic
1095640744 12:44482720-44482742 GAAGAAGTGCAGAATGAAGACGG + Intergenic
1095712888 12:45308946-45308968 AAGGAAGGGAAGAAAGAAGAGGG + Intronic
1095922754 12:47546983-47547005 AAGGAAGTGCAAAAAGAAGAAGG + Intergenic
1096716954 12:53497368-53497390 AGGGAGGTGGAGAAACAAGAGGG + Intronic
1097300228 12:58010131-58010153 GTGGGGGTGCAGAATGATGATGG + Intergenic
1097480348 12:60116371-60116393 AAGGAGATGAAGAATAAAGGTGG + Intergenic
1097826898 12:64183475-64183497 AAGCAGGTGGAGAATGCATAGGG - Intergenic
1100124778 12:91410498-91410520 AAGGAAGTGAGGAACGAAGAGGG - Intergenic
1100371907 12:93976225-93976247 TAAGAGGTGCAGAAAGAAGTAGG - Intergenic
1100405651 12:94270888-94270910 AAAGGGGAGCAGAGTGAAGAGGG + Intronic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100638445 12:96458383-96458405 AAGGAGATGTAGAAAGAAAAAGG - Intergenic
1100737893 12:97558078-97558100 GAGGAGGTGATGAAGGAAGAGGG - Intergenic
1100937568 12:99687523-99687545 AATGAAGTACAGAAAGAAGAAGG - Intronic
1101147658 12:101856223-101856245 CAGGAAGTGCAGAGTGAAGGTGG - Intergenic
1101282102 12:103268936-103268958 AGGCAGGTGCAGGATGAAGCAGG + Intronic
1101483725 12:105129731-105129753 AGGGACATTCAGAATGAAGAGGG + Intronic
1102091262 12:110190269-110190291 AAGGAGGTGCAGTGAGAATAAGG - Intronic
1102313138 12:111863010-111863032 GAGGAGGTGGTGAGTGAAGATGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103231791 12:119337287-119337309 AATGAGGGAAAGAATGAAGAGGG + Intronic
1103609351 12:122112725-122112747 AAGGGGGTGTATGATGAAGATGG + Intronic
1104553177 12:129776156-129776178 AAAGAAGTCCAGAATAAAGATGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105343919 13:19556172-19556194 AAGGAAGTGCAAAATGCATAGGG - Intergenic
1105536118 13:21265416-21265438 AAGGAAGTGCAAAATGCATAGGG + Intergenic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1106828953 13:33557199-33557221 AAGGAGGGAGAGAAGGAAGAGGG - Intergenic
1106944778 13:34815191-34815213 AAGGAGGTACTAATTGAAGATGG - Intergenic
1107212729 13:37876737-37876759 AAGGAAGTAGATAATGAAGATGG + Intergenic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1107668587 13:42718680-42718702 AAGAAGGAGGAGAAAGAAGAGGG + Intergenic
1108038335 13:46315741-46315763 AAGGAGGTTAAGAAAGTAGAAGG + Intergenic
1108851838 13:54739513-54739535 AGAGAAGTGCAGAGTGAAGAGGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109540860 13:63777068-63777090 AAGGATGTGGAGAAATAAGAAGG - Intergenic
1110590114 13:77246602-77246624 GAGGAGGAGAAGAAAGAAGAAGG + Intronic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110945574 13:81411406-81411428 GAGGAGGAGGAGAAAGAAGAAGG - Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111517057 13:89348311-89348333 AGAGAAGTGCAGAGTGAAGAAGG + Intergenic
1111736447 13:92146025-92146047 AAAGAGGTGCAAAATTAAAAAGG + Intronic
1112241128 13:97682284-97682306 AAGGGGGTGGAGAAAGATGAAGG + Intergenic
1112278244 13:98040307-98040329 AAGAAGGTGAAGACTGAATAAGG - Intergenic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1112516693 13:100059235-100059257 AAGGTGGTGCACACTGGAGAGGG + Intergenic
1112578248 13:100656342-100656364 AAGAAGGTGGAAAATTAAGAAGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1115054520 14:29106503-29106525 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115597692 14:34924855-34924877 AAGGAGGTGGAGAGAGAAGGAGG - Intergenic
1115912775 14:38274925-38274947 ATGGAGGTGGAGAACAAAGAGGG + Intergenic
1116601062 14:46923373-46923395 ATGAAGGTGCAGAATGGAGATGG + Intronic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118130591 14:62958611-62958633 AAAAAGGTAGAGAATGAAGAGGG - Intronic
1118774770 14:68966902-68966924 AGGAAGGGGCAGGATGAAGAGGG + Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1120028727 14:79615666-79615688 AGGGAAGTGCAGAGTGAAGGGGG + Intronic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120975022 14:90240834-90240856 AAGGAAGTTCAGAGAGAAGAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123792337 15:23734330-23734352 AAGAAGGAGAAGAAAGAAGAAGG + Intergenic
1124926514 15:34075345-34075367 AGAGAAGTGCAGAGTGAAGAGGG + Intergenic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125319393 15:38468038-38468060 AAGGATCTGCAAAAGGAAGAAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126401665 15:48277364-48277386 AAGGAGGTGAGGATTGATGATGG + Intronic
1126841324 15:52719996-52720018 AAGGAGGTGCAGAATTCAGAAGG - Intergenic
1127137742 15:55942512-55942534 AAGGAGGAGGAGAATGAAGGGGG - Intronic
1127244634 15:57158626-57158648 AAGCTGGTGCAAAATTAAGATGG + Intronic
1127395572 15:58541710-58541732 CAGGAGCTGGAGAAGGAAGAAGG + Intronic
1127546854 15:60000424-60000446 AAGGAGATGCAAAAAGCAGAAGG + Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1128828935 15:70748635-70748657 AGGGAGGGGTAGAATGAACAGGG - Intronic
1129552385 15:76467057-76467079 AAGGAGGAGGAGAGTGAAGGAGG - Intronic
1129596736 15:76970634-76970656 AAGGAGGTACAGATGGAAGAAGG + Intergenic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130095416 15:80851916-80851938 AAGGAGGAGGAGACTGGAGATGG + Intronic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1130285634 15:82552203-82552225 AAAGAAGAGCAGAATAAAGACGG + Intronic
1130896136 15:88171795-88171817 AGGGAGGGGGAGAAAGAAGAAGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133611774 16:7440372-7440394 AAGGAGGTAGAAAATGAATATGG + Intronic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1134136817 16:11682102-11682124 AAGCAGGTGGACAATGAAAAAGG + Intronic
1134348021 16:13409485-13409507 CAGGAGGTGGAGCATGCAGAGGG - Intergenic
1135173776 16:20210078-20210100 AGGGAGGAGTAGAATGGAGAGGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1136143284 16:28300961-28300983 AAGGAGGTGAAGGATGCAGCTGG + Intronic
1136556883 16:31012116-31012138 ACGGAGGTGCAGAAAGATGCAGG - Intergenic
1136642512 16:31578705-31578727 AAAGAAGTGCAGAATGAAGGGGG - Intergenic
1137512481 16:49113819-49113841 GAGGAGGTGCAGGGTGGAGACGG + Intergenic
1137530597 16:49276549-49276571 CAGCAGGTGGAGAAAGAAGAGGG + Intergenic
1138034916 16:53594388-53594410 ATAGAAGTGCAGAATGAAGAGGG - Intergenic
1138141055 16:54568843-54568865 GAGGAGGTGGAGAAGGGAGAAGG + Intergenic
1138260308 16:55615436-55615458 AAAGAGGAACAGAAGGAAGATGG + Intergenic
1138541608 16:57691080-57691102 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138541623 16:57691135-57691157 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1140120683 16:72080721-72080743 AAATAGCTGCAGAATCAAGAAGG + Intronic
1141850661 16:86643268-86643290 AAGGGGTGGCAGAAGGAAGATGG - Intergenic
1141902695 16:87003016-87003038 GGGGAGGTGCAGGGTGAAGATGG + Intergenic
1142296912 16:89230211-89230233 AAGGAGGGGCAGAGTGGAGAGGG + Exonic
1143208715 17:5166816-5166838 GGGGTGGTGTAGAATGAAGAAGG - Intronic
1143434378 17:6912837-6912859 AAGCACGTGCAGTCTGAAGAAGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1144646145 17:16974904-16974926 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1144776147 17:17785657-17785679 AAGGAGGTGCAGAGAGGAGGGGG - Intronic
1144894664 17:18520765-18520787 GGGGTGGTGTAGAATGAAGAAGG + Intergenic
1145099208 17:20059586-20059608 AAGGAGGACCAGAAAGAAAAGGG - Intronic
1145137561 17:20423479-20423501 GGGGTGGTGTAGAATGAAGAAGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146701249 17:34962075-34962097 AAGGAGATGGAGAAAGAAAAAGG + Exonic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148554109 17:48567620-48567642 AACGGGGTGCAGATTGGAGAGGG - Intronic
1148558315 17:48591691-48591713 GAGGAGGAGGAGAATGAAAAGGG + Exonic
1148715068 17:49710108-49710130 AAGGCTGTCCAGAATGAAGAGGG - Intergenic
1148814083 17:50314191-50314213 AAGGAAGGGAAGAAGGAAGAGGG + Intergenic
1149121787 17:53177102-53177124 AAGGAGGTGGAGGAAGAGGAGGG - Intergenic
1149496675 17:57122730-57122752 AAGGAGGAGCAGATTTATGAAGG + Intergenic
1149819866 17:59765750-59765772 AAGGAGGTGGAGGAGGTAGATGG + Intronic
1150118182 17:62574006-62574028 AAGGAAGAGAAGAATGGAGAAGG - Intronic
1150915979 17:69437384-69437406 AAGGAGGAGGAGGAAGAAGAGGG + Intronic
1151996101 17:77610016-77610038 AAGGGGGTGAGGAAGGAAGAGGG + Intergenic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152838417 17:82550366-82550388 AAGGGGGTGCAGGAGCAAGATGG + Intronic
1153179916 18:2421343-2421365 AAGGATGTGCAGTATGGAGATGG - Intergenic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1153845090 18:9042335-9042357 AAGGAACTTCAGCATGAAGATGG + Intergenic
1153878882 18:9403530-9403552 AAGGAGTTGCAGAAGGATCAAGG + Intergenic
1153879550 18:9408473-9408495 AAGTAGGGAGAGAATGAAGAAGG + Intergenic
1155040968 18:22065536-22065558 ATGGAGGTGAAGAAGTAAGAGGG + Intergenic
1155902795 18:31411678-31411700 AGGGAAGTGGAGAATGATGAGGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156302573 18:35848307-35848329 ATGGTGGTGCAGAATATAGAAGG - Intergenic
1156370563 18:36468399-36468421 GAGGTGGTGGAGAAAGAAGAGGG + Intronic
1156490672 18:37494110-37494132 AAGGAGGTGCAGACCTCAGAGGG + Intronic
1156791699 18:40983823-40983845 AAGGAGGTGGAGAAGGAGGAGGG - Intergenic
1156972196 18:43170249-43170271 AAAGGGGTACAGACTGAAGATGG - Intergenic
1157429397 18:47612314-47612336 TAGGAGGTGCCCAATGAAGGTGG + Intergenic
1157579344 18:48764438-48764460 ACAGAGGTGCAGAAAGTAGAGGG - Intronic
1157661486 18:49448739-49448761 AGGGGAGTGCAGGATGAAGATGG - Intronic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1159091265 18:63851916-63851938 AAGGAGGTCCAGAATTATTAGGG - Intergenic
1159174431 18:64814868-64814890 AGGGAAGTGCAGACTGAAGATGG - Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159454654 18:68645180-68645202 AAAGAAGTGCAGAGTGAAGTGGG - Intergenic
1159872437 18:73773760-73773782 CAGGAGCTGCAGAATTAAGAAGG - Intergenic
1159933352 18:74337687-74337709 AAGGACACGCAGAATGAATAAGG - Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160602245 18:80022637-80022659 AGGGAAGTACAGAATGCAGATGG + Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1163177900 19:15577325-15577347 AAGGAAGTGGGGAAGGAAGATGG - Intergenic
1163214056 19:15863108-15863130 AAGGATGTGCGGGATGAAAAAGG - Intergenic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164077995 19:21837853-21837875 GAGGAGGTGGAGAAGGAAAAAGG - Intronic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165416072 19:35694257-35694279 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1165729157 19:38133331-38133353 AAGGAATGACAGAATGAAGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166371409 19:42303250-42303272 AAGAAGGTGCAGAAAGAGAAAGG + Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166814063 19:45531509-45531531 GAGGAGGAGCAGTATGAAGGAGG - Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925858378 2:8152138-8152160 AGGCAAGTGCAGAATGCAGAGGG + Intergenic
925903246 2:8523519-8523541 GAGGAGGTGCTCAATGAAGGTGG - Intergenic
925933413 2:8730148-8730170 TAGGAAGTACATAATGAAGAGGG - Exonic
926100413 2:10112604-10112626 AAGAAGGTGCAGTATAAAAATGG + Intergenic
926788662 2:16546957-16546979 AAGGAGGTGGAGAATGACCTGGG + Intergenic
926861773 2:17317493-17317515 AAGGAGGAGGAGAAGGAAGTGGG + Intergenic
928103971 2:28455677-28455699 CAGGAGGTGGAGCATGCAGATGG - Intergenic
929878991 2:45820447-45820469 AAGGAAGGGCAGAATGAGAAAGG + Intronic
930093946 2:47552376-47552398 AAGGAAGTGGGGAATGAAGCAGG - Intronic
930262777 2:49166649-49166671 AAGGAGGTGAGGCATGAGGAGGG + Intergenic
930363440 2:50410744-50410766 AAGGAGATGCAGAGTATAGATGG + Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931942968 2:67273285-67273307 AGGGAGGTGGAGAAGGAAGTGGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932208165 2:69902298-69902320 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
932802355 2:74752158-74752180 AAGGAGGAGGAGAATCAATATGG - Intergenic
932922589 2:75934136-75934158 AATGAGGTTCAGAATGATGATGG - Intergenic
933465574 2:82646800-82646822 AAAGAAGTGCAGAATGAAGGGGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933859187 2:86447440-86447462 AAAAAAGTGCAGAATTAAGAAGG - Intronic
933969709 2:87460470-87460492 AAGGAGCTGGAGGAGGAAGATGG + Intergenic
934650839 2:96090505-96090527 AAGGAGGCCCAGAATGCAGCCGG + Intergenic
934736860 2:96694010-96694032 AAGGAGTTGGGGAAGGAAGAGGG + Intergenic
935535051 2:104284168-104284190 AGGTAGGCCCAGAATGAAGAAGG - Intergenic
935926098 2:108070879-108070901 AAGGAGGTCTACAATGTAGAAGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936324074 2:111490027-111490049 AAGGAGCTGGAGGAGGAAGATGG - Intergenic
936702939 2:115035636-115035658 AAGGATGTGAGGAATGAAGTGGG - Intronic
936828237 2:116607623-116607645 AAGGATTTGGAGAATGCAGAGGG - Intergenic
937040622 2:118817863-118817885 AAGTAGTTCCAGAATGAAAACGG + Intergenic
937573360 2:123390992-123391014 GGGGAGGAGGAGAATGAAGAAGG - Intergenic
938765490 2:134458377-134458399 AAGCAGGTACAGAATGATGGTGG - Intronic
939355265 2:141093371-141093393 AAGGAGGTGAAGGATTGAGAAGG + Intronic
939395901 2:141629247-141629269 AAGGAGGGGTACAAGGAAGATGG + Intronic
941242214 2:163053555-163053577 AAGGAGGAGAAAGATGAAGAAGG + Intergenic
941328929 2:164152650-164152672 ACAGAGGTGGAGATTGAAGAAGG + Intergenic
941809250 2:169739032-169739054 AAGGAGGAGGAGGAAGAAGAAGG - Intronic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942378058 2:175357120-175357142 GAGGAGGTGCAATGTGAAGATGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943770843 2:191714601-191714623 GAGGAGGAACAGAATAAAGAAGG + Intergenic
944300731 2:198121862-198121884 AAGGAGGAGAAAAATAAAGATGG - Intronic
945499390 2:210551650-210551672 AAGAAGGTGAAAAATGAAGCTGG - Intronic
945855401 2:215063502-215063524 GAGCAGGTGAAGAATGAATAGGG - Intronic
946020927 2:216639453-216639475 AAGGAGGAGCAGAACAAAAAGGG + Intronic
946456307 2:219829330-219829352 AAAGAGCTGCAGAATGAAACAGG + Intergenic
946474735 2:219996322-219996344 TAGGAGGTGAAAAATGAAGGTGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946537854 2:220650920-220650942 AAGGCGGTGCAGAAATGAGAAGG - Intergenic
946874633 2:224115223-224115245 AAAGAAGTGCAGAGTGAAGGGGG - Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947708226 2:232293493-232293515 AAGCAGGTGGAGCATGAGGAAGG + Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948339565 2:237238552-237238574 GAGGAGGAGCTGAATGAAGGAGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949081138 2:242100596-242100618 AAGGAGGTGGTGGATGAGGAAGG + Intergenic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1170082251 20:12490062-12490084 AAGGAAGGGAAGAATGAAGCAGG + Intergenic
1170427333 20:16247750-16247772 GAGGAGCTCCTGAATGAAGAGGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173221151 20:41134240-41134262 AAGGAGGTGCAGGAAAAACAGGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174740369 20:53007331-53007353 AAGGAGGTTCAGAAATCAGATGG + Intronic
1175534075 20:59695356-59695378 AAGGAGGAAGAGAATGAAGCAGG - Intronic
1176697330 21:9995236-9995258 AAGGAGGGGGAGAAGGAAGAAGG + Intergenic
1176720411 21:10388120-10388142 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1177414533 21:20776923-20776945 AAAGTGGTACAGACTGAAGATGG + Intergenic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178298519 21:31431194-31431216 AAGGCGGTGCAGAATTAGGTAGG - Intronic
1178321818 21:31611606-31611628 AGGGAAGTGCAGAGTGAAGTGGG - Intergenic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1178338477 21:31765293-31765315 CAAGAAGTCCAGAATGAAGAGGG - Intergenic
1178717919 21:34983771-34983793 AAGGAAGAGGAGAATGAAGTTGG + Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178909678 21:36664398-36664420 GAGGGGGTGCAGAAGGAAAAGGG + Intergenic
1178949688 21:36975846-36975868 CAGGAGGTGCAGAATGAACGTGG - Intronic
1179227388 21:39466639-39466661 AGAGAAGTGCAGAGTGAAGATGG + Intronic
1179328027 21:40369182-40369204 AAAGATGTACAGAATGAAGATGG - Exonic
1179899928 21:44385797-44385819 GAAGAGGTGCCAAATGAAGAAGG + Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1180636973 22:17269355-17269377 AAGGAGGTGTAGAGTGAATGGGG - Intergenic
1181103711 22:20558773-20558795 AAGCAGGTGCAGATTGGAGCAGG + Intronic
1181170112 22:21003362-21003384 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1181494364 22:23279631-23279653 GAGGAAGTGGAGAAGGAAGACGG - Intronic
1181977198 22:26738428-26738450 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1182102473 22:27667791-27667813 AAGGGGGTGCAGAATATAGGGGG + Intergenic
1182706373 22:32283133-32283155 AAGGGGTTGCAGAATGCAGAAGG - Intergenic
1182755881 22:32678546-32678568 AAGGAGGAGGAGGATGAAGGAGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183797674 22:40133539-40133561 AAGGAAGTCCACAATGGAGAGGG + Intronic
1183955051 22:41374822-41374844 GAGGAGGTGGAGGAAGAAGAGGG + Intronic
1184288749 22:43487004-43487026 AGGATGGTGCAGAGTGAAGAGGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184433988 22:44458916-44458938 AAGGATATGTAGGATGAAGATGG - Intergenic
1185129196 22:49028092-49028114 ATGGAGGTACAGAAGGAAGGAGG + Intergenic
1185139162 22:49090654-49090676 AAGGTGCTGCAGAATGAGGCTGG + Intergenic
1185289997 22:50018881-50018903 AAAGTGGTTCAGAATGAACATGG + Intronic
949145566 3:695630-695652 AATGATGTGAAGAATGATGATGG + Intergenic
949171842 3:1009223-1009245 ATGTAGCTGCACAATGAAGAAGG - Intergenic
949994758 3:9607925-9607947 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
949997647 3:9631137-9631159 AAGGAGTTGGCTAATGAAGATGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950536435 3:13581671-13581693 AAGGAGGGGGAGAATGCAGGCGG + Intronic
950788396 3:15453944-15453966 AAGGAGGTGCAGTCTTGAGAAGG + Intronic
952720771 3:36530299-36530321 AAGGAAGTTCACAATGAAAAAGG + Intronic
954436641 3:50499840-50499862 AAGGAGGTGCCTGATAAAGATGG + Intronic
954813464 3:53262397-53262419 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
955071879 3:55578406-55578428 AAGGAGGTGCAGACTGTGGTAGG - Intronic
956049760 3:65235367-65235389 TAGGAGGTGGAGGATGGAGAAGG - Intergenic
956780824 3:72601752-72601774 AAGAAGGGGCAAAAGGAAGAAGG + Intergenic
957457445 3:80470504-80470526 CAGGATGTGTAGAATGAACAAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
963293921 3:143524056-143524078 AAGGAAGACCAGAATGTAGAAGG + Intronic
963671475 3:148257504-148257526 AGGAAAGTGCAGAGTGAAGAGGG - Intergenic
963988220 3:151622480-151622502 AAGGAGGAGAAGAAGAAAGATGG - Intergenic
964172368 3:153785927-153785949 AAGGAGGAGCAGAATAAACTGGG + Intergenic
965524555 3:169702190-169702212 AAGGAGGGGTGGAATGTAGATGG - Intergenic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966588742 3:181655881-181655903 AAGGAGTTGAAGGAGGAAGAAGG - Intergenic
966700165 3:182840688-182840710 AAGGAGGTGAAGAAAGACGAAGG - Intronic
967363082 3:188654247-188654269 GAGGAGGTTCAGAAGGAAAATGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968126380 3:196163584-196163606 AAGGACGGGTAGAAGGAAGAGGG - Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969340060 4:6535007-6535029 AAGGAGGTGGCGCATGAAGGGGG + Intronic
969360571 4:6660716-6660738 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969960841 4:10943547-10943569 CAGGAGGGGTAGAAGGAAGAGGG - Intergenic
970206078 4:13656904-13656926 AAGGAGGGGCACAGAGAAGAGGG - Intergenic
970253078 4:14137049-14137071 AAGGAGCTGCAGAAACAAGGAGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971239144 4:24872049-24872071 AAGGAAGAGCAAAGTGAAGAAGG + Intronic
971732066 4:30397162-30397184 AAGGAGGAGGAGAAAGAAAAAGG - Intergenic
971737609 4:30476022-30476044 AAGAAGGTGGAGAATGAGAATGG - Intergenic
971745098 4:30569084-30569106 ATAGAGGTCCAGATTGAAGAAGG - Intergenic
971754814 4:30694068-30694090 AAGGAGGTACTCAATGAAGAAGG - Intergenic
971865670 4:32168299-32168321 AAAGAGGAGGAGAAAGAAGAAGG - Intergenic
972030540 4:34451707-34451729 ATGAAGGTGAACAATGAAGAAGG - Intergenic
972579839 4:40385486-40385508 AAGGAGGGAGAGAAGGAAGAAGG + Intergenic
972598553 4:40551597-40551619 AAGGAAGTACACAAGGAAGAGGG + Intronic
972922576 4:43962182-43962204 ATGCAGGTGCATGATGAAGATGG + Intergenic
973805690 4:54524088-54524110 ACGGAGGTTCAGAATCCAGATGG - Intergenic
974304968 4:60124402-60124424 AAGGAGGTAGAGAATGAGGTAGG + Intergenic
974364837 4:60933513-60933535 CAGGTGGTACAGAATGAAGCAGG - Intergenic
974831482 4:67194758-67194780 AAGGAGGTAGAGAAAGAAGGTGG + Intergenic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
976208513 4:82644301-82644323 AAGAAGGGGCAGAAGCAAGATGG - Intronic
976261421 4:83148610-83148632 AAGGAAGTACAGAGTGAAGGAGG + Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977097427 4:92764057-92764079 CATGAGGTGGAGAATAAAGAGGG - Intronic
977416891 4:96744246-96744268 AAGGAGGAGGAGAACAAAGAGGG - Intergenic
977509136 4:97938899-97938921 AAGGAGGGGCAGACCCAAGATGG - Intronic
978048464 4:104164912-104164934 AAGGATGTAGAGAAAGAAGACGG + Intergenic
978399895 4:108320277-108320299 AAGGAGGTGGAGAGGGAAGTGGG - Intergenic
978633033 4:110769113-110769135 AAGGAGGTGCTCAATAAAGAAGG - Intergenic
979515787 4:121608562-121608584 AAGGGGGTGCAGTATGGAGAGGG - Intergenic
979814702 4:125086431-125086453 AAGGAGGTGGAGAGAGAGGAGGG - Intergenic
981604121 4:146524099-146524121 AAGGAGGTGCAACGTGAAGATGG - Intergenic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
983315283 4:166124480-166124502 AAGAAGCTTGAGAATGAAGAAGG + Intergenic
984044084 4:174776005-174776027 AAGGAGGTGGAGAGTGAGAAGGG + Intronic
984137507 4:175959268-175959290 TAAGCTGTGCAGAATGAAGATGG - Intronic
984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG + Intronic
985381013 4:189394821-189394843 AGGAAGGTGCAGAAAGGAGAGGG - Intergenic
985388272 4:189467526-189467548 AAGCAGGTGCAGAGGGAAAATGG + Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
986063546 5:4213896-4213918 GAGGAGGAGGAGAAAGAAGAGGG + Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
987086229 5:14471107-14471129 AAGGAGGTGGAGAAAAAAGTTGG - Intronic
987541567 5:19262042-19262064 AGAGAGGTGCAGAGTGAAGCAGG - Intergenic
987775992 5:22367188-22367210 AAAGTGGTGCAGAAAGGAGAAGG - Intronic
987985795 5:25144179-25144201 AAGGAGGAGGAGGAGGAAGAGGG + Intergenic
988027840 5:25722263-25722285 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
988299696 5:29405785-29405807 AGAGAAGTGCAGAGTGAAGAGGG - Intergenic
988379304 5:30480295-30480317 AAAGAAGTGCAGAGTGAAGCAGG + Intergenic
989346340 5:40434102-40434124 AATGGAGGGCAGAATGAAGAGGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990311488 5:54543229-54543251 ATGGAGGTGCAGAAGGCTGACGG + Intronic
991336614 5:65555283-65555305 AATGAGGTCAAGGATGAAGAGGG + Intronic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992116320 5:73541441-73541463 AAGGAGGTGGAGAGTCAAAAAGG + Intergenic
992226037 5:74620489-74620511 AAGGAGGGGTAGCATGCAGATGG + Intergenic
992266948 5:75028838-75028860 ATGGAGCTGCAGAATTAAGGTGG - Exonic
993323754 5:86508134-86508156 AAGAAGCTGCAGAATGCAGAGGG - Intergenic
993815371 5:92538154-92538176 AATGAGATGAAGAATAAAGAAGG - Intergenic
993835301 5:92812476-92812498 AAAGAGGAGCAAAAGGAAGAAGG + Intergenic
994214974 5:97127533-97127555 AATGAAGTGCAGAGGGAAGAAGG + Intronic
994450808 5:99940212-99940234 AAGGAAGTGCAAAAGAAAGAAGG - Intergenic
995189248 5:109303182-109303204 ACGGAGGTGCAGAATGAGCCCGG - Intergenic
995988289 5:118207353-118207375 AGGGAGGTGCTGAGTGAAGGGGG - Intergenic
996179188 5:120398616-120398638 GAGGAAGTGCACAGTGAAGAGGG - Intergenic
996566405 5:124883609-124883631 AAGGAGGAGCTGCATCAAGAGGG - Intergenic
996905452 5:128594891-128594913 AAGGAGGTGCAGATTTAATCTGG + Intronic
998015600 5:138729509-138729531 AAGGAGGTGGAGAATGAGGGAGG + Intronic
999044839 5:148455921-148455943 GAGGAGGAGGAGGATGAAGAGGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003817622 6:9859929-9859951 GAGGAGGAGGAGGATGAAGAAGG + Intronic
1003821866 6:9907061-9907083 AAGGAACTTCAGAAAGAAGAGGG + Intronic
1003955980 6:11165317-11165339 AGGAAGGTGCAGCAGGAAGAAGG - Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004343571 6:14828390-14828412 AAGGAGCTGCAGAAAAAGGAGGG + Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1006916581 6:37598153-37598175 AAGGAAATGCAGTATGAAAAAGG - Intergenic
1007543444 6:42671657-42671679 ATTGAGTTTCAGAATGAAGAAGG - Intronic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008171916 6:48218287-48218309 ATGGAGGTGAAGAATGTAAATGG - Intergenic
1008334302 6:50281820-50281842 AAGGAAGTCCACAAGGAAGAGGG + Intergenic
1008979034 6:57462226-57462248 AAGGAGGTATAAAATGATGAAGG + Intronic
1009567311 6:65325218-65325240 AAGGATGAGGAGGATGAAGAAGG - Intronic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1010369480 6:75090388-75090410 GAGGGGTTGCAGAATGGAGATGG - Intronic
1011236701 6:85226605-85226627 AGAGAAGTGCAGAGTGAAGAGGG + Intergenic
1011484783 6:87830104-87830126 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1011639693 6:89407329-89407351 AAGGAGGTAGAGAAGAAAGAAGG + Intronic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011887150 6:92110069-92110091 AATGAGGCGGAGAATCAAGATGG - Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1013038905 6:106414297-106414319 AAGAAGCTGCACAAGGAAGATGG + Intergenic
1013215828 6:108026396-108026418 AAGTGGGTGGAGAGTGAAGATGG + Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013740282 6:113275692-113275714 AAGGAGGGGAAGGAGGAAGAGGG + Intergenic
1014044330 6:116866997-116867019 AAGGAGGAGCAGGTTGAAGAAGG - Intergenic
1014251716 6:119122187-119122209 CTGGAGGTCCAGAATGGAGAGGG - Intronic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1015128120 6:129777142-129777164 AAGGAGGAGGAGAGTGAAGGGGG + Intergenic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1018371329 6:163170836-163170858 AAGGAGTGGGAGAATGAAGGAGG - Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018475121 6:164132781-164132803 AAGGAAGGGCAGAAAGAAAAAGG - Intergenic
1018868488 6:167763497-167763519 AGAGAAGTGCAGAGTGAAGAGGG - Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1020882171 7:13775927-13775949 AAGGAGGTGGGGAAGGAAAATGG - Intergenic
1021287075 7:18793551-18793573 AAGGAAGGGCAGAAGGAAGAGGG + Intronic
1021926031 7:25534637-25534659 AAGGAGGTTCTGAATGGACAAGG - Intergenic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1023620745 7:42069655-42069677 AAAGAAGTACAGAGTGAAGATGG + Intronic
1023694494 7:42830653-42830675 AAGGAGGTGAACATAGAAGATGG + Intergenic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024295970 7:47842592-47842614 AAGCTGGTGGAGGATGAAGATGG - Intronic
1024630771 7:51244998-51245020 AAGGAGGTGTGGAAAGAGGAAGG - Intronic
1024846255 7:53646173-53646195 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1025270444 7:57507773-57507795 ATGAAGGTGAACAATGAAGAAGG + Intergenic
1025286359 7:57665203-57665225 AAGGAGGTGAAGTCTGAAGTGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026373050 7:69721088-69721110 AAGGAGATGAAGAATGACCAGGG + Intronic
1026684923 7:72501457-72501479 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1026839740 7:73663466-73663488 GAGGAAGTGCAGGATGTAGAGGG + Intergenic
1027292178 7:76726088-76726110 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
1027464935 7:78503593-78503615 AAGGAGGGGGAGAAGGAGGAGGG - Intronic
1028642065 7:93053620-93053642 AAGGAGGTGGAGGCTGCAGATGG + Intergenic
1029202644 7:98849310-98849332 AAGGAGATGCAACAAGAAGAGGG + Intronic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1030522203 7:110611739-110611761 TAGGAGGGGCAGAAGGAAGAGGG + Intergenic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1031011670 7:116530566-116530588 AAGGAGGTGCAGTTTGAATTGGG + Intronic
1031745733 7:125495533-125495555 AGGGAGGTGCAGAATTACGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032466797 7:132151257-132151279 AAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032493208 7:132340572-132340594 AAAGAGGGGCATAATGGAGAAGG + Intronic
1032523110 7:132561274-132561296 AAGGAGGAGGAGGAGGAAGAGGG - Intronic
1032523465 7:132562779-132562801 GAGGAGGTGGAGAAAGAAGAGGG - Intronic
1032978342 7:137251685-137251707 AAGGAGGTGGGGAAGGAGGAAGG - Intronic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1033528755 7:142243112-142243134 AGGGAAGTGCAGAAGGAAGAAGG - Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033832593 7:145271494-145271516 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1033832617 7:145271659-145271681 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034427273 7:151020626-151020648 AGGGAGGAGCAGACTCAAGATGG + Intronic
1034456882 7:151175463-151175485 AAGGAGGTGCAGGGTGCACATGG - Intergenic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1035037593 7:155905477-155905499 TATGAGGTGCAGAATGTAGGCGG - Intergenic
1035331868 7:158101844-158101866 AGGGTGGGCCAGAATGAAGAAGG - Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035936926 8:3851738-3851760 AAGAAGGTGAGGAATGAAGAGGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036816270 8:11905231-11905253 ACTGAGGTGCAGGATGAAAATGG + Intergenic
1037476494 8:19262875-19262897 TAGAAGATGCAGAATGAAGGAGG - Intergenic
1037541512 8:19876392-19876414 AAGGGAGTGGAGAGTGAAGAGGG - Intergenic
1038943377 8:32330476-32330498 AAGGATGTGGAGGAGGAAGATGG + Intronic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1040051309 8:43017087-43017109 AAGGATGTGCAGAAGACAGAAGG - Intronic
1041291160 8:56310104-56310126 AAGGAGGAGGAGAAGGAAGGAGG + Intronic
1042150859 8:65782059-65782081 AAGTAGGTGAAGAATAAGGATGG + Intronic
1042359893 8:67870449-67870471 AAAGTGCTGCAGAATGAAGCTGG + Intergenic
1042605337 8:70540615-70540637 AAGGAGGACTAGAATGAAGGGGG - Intergenic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1043348603 8:79330923-79330945 AAGGAGGGGCAAAAAGAAGGAGG - Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1044460988 8:92443690-92443712 AAGGAGGAGCAGGTTGGAGATGG + Intergenic
1045182267 8:99797073-99797095 TAGGAGGGAGAGAATGAAGATGG + Intronic
1045289684 8:100821854-100821876 AAGCAGGTTCAGAATTCAGAAGG - Intergenic
1045522417 8:102914803-102914825 AAGAAGGTGCAGATTGAGGGGGG - Intronic
1045758807 8:105578237-105578259 AAGAAGATGCAAAATGAAAATGG - Intronic
1045835382 8:106514520-106514542 GAGGAGGGGGAGAAAGAAGAAGG + Intronic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046176255 8:110578770-110578792 GAGGAGGAGCAGAATAAAGTAGG - Intergenic
1046524616 8:115368800-115368822 AGGGAGGTGCTGTATGAAGCTGG - Intergenic
1046732057 8:117736502-117736524 GAAGAGGAGGAGAATGAAGATGG + Intergenic
1046755915 8:117972778-117972800 TAAGAAGTGCAGAGTGAAGAGGG + Intronic
1047063282 8:121251576-121251598 AAGTAGGTGCAGTATGAGAAAGG - Intergenic
1047535941 8:125719650-125719672 CAGAAGGTGTGGAATGAAGAAGG - Intergenic
1047633767 8:126736710-126736732 ATAAAGGTGCAGATTGAAGAAGG + Intergenic
1047928609 8:129704441-129704463 AGGGAGGGGCAGAAGGAAAAAGG - Intergenic
1048132924 8:131717512-131717534 AAAGAAGAGCAGAAAGAAGATGG + Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048443026 8:134473928-134473950 AAAGAGATGCAGAATGGAGGAGG + Intergenic
1048749007 8:137649797-137649819 AAGGAGGGGCAAAAAGAACAGGG + Intergenic
1048790403 8:138098442-138098464 AATGAGGCACAGATTGAAGATGG - Intergenic
1049261328 8:141640748-141640770 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1049436140 8:142587131-142587153 AAGGAGGAGCAGCGTGTAGAAGG + Intergenic
1049499510 8:142954185-142954207 GAGGAGTTGCAGAGTGCAGAGGG + Intergenic
1049514850 8:143048816-143048838 AAGGAGGTGGAAAATGCATAAGG - Intronic
1050488878 9:6166053-6166075 AAGGAGATGCAGAAAGTAAAAGG + Intergenic
1051782063 9:20699842-20699864 GAGGAGGAGGAGAACGAAGAAGG - Intronic
1051857474 9:21585494-21585516 AAGGAGGAGCTGTGTGAAGATGG + Intergenic
1052866151 9:33465821-33465843 AAGGAGGTGCAGAGCCCAGAGGG - Exonic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053771430 9:41482418-41482440 AAGGAGGGGGAGAAGGAAGAAGG - Intergenic
1054925215 9:70581907-70581929 AAGGAGGGAAGGAATGAAGAAGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055657171 9:78462523-78462545 AAGGGATTGCAGAAAGAAGAAGG + Intergenic
1056271945 9:84955254-84955276 AAGGACATGGAGAATGAAGCTGG - Intronic
1056473303 9:86926857-86926879 AAAGAGGTCCACAATGCAGAGGG - Intergenic
1056523129 9:87418590-87418612 AAGGATGAGCATAAAGAAGAGGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1056780574 9:89546783-89546805 AAGGAGGTGCTCCATGAATACGG - Intergenic
1057567293 9:96176921-96176943 AGGGAGGTGCAGAGTTCAGAAGG + Intergenic
1058217697 9:102255417-102255439 GAGGAGTTGCGGAATGAAGAAGG - Intergenic
1058345008 9:103950821-103950843 AAGGAGGGAAAGAAGGAAGAAGG + Intergenic
1058561481 9:106233369-106233391 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1185993457 X:4916950-4916972 ATGTAGGGGCAGAATGTAGAAGG - Intergenic
1186109889 X:6244639-6244661 AAGGTTGTGCAAATTGAAGAAGG - Intergenic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186557165 X:10572000-10572022 AAGGAGGTAAAGTATGAAGTGGG + Intronic
1187025794 X:15434156-15434178 AAGAAGGAGGAGAAAGAAGAAGG + Intronic
1187025825 X:15434363-15434385 AAGGAGGAGGAGAAAAAAGAAGG + Intronic
1187549050 X:20282970-20282992 AAGGAGTTGCAAATTCAAGATGG - Intergenic
1188344391 X:29045976-29045998 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189307440 X:39997495-39997517 AAGGAATTGCAAAAGGAAGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189877482 X:45451724-45451746 TAGGAGGTGCAAAATGGAGCTGG - Intergenic
1190548923 X:51558731-51558753 AAAGGGGTACAGACTGAAGATGG + Intergenic
1191590883 X:62883332-62883354 GAGGAGGTTTAAAATGAAGAAGG - Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192503002 X:71665503-71665525 GAGGAGGAGGAGGATGAAGAGGG + Intergenic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1195326586 X:103763400-103763422 ATGGTGGTGCAGAATATAGAAGG + Intergenic
1195664336 X:107415207-107415229 GAGGAGGTGGAGGATGAGGAGGG + Intergenic
1196081450 X:111637225-111637247 AAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1196477755 X:116108601-116108623 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1197462973 X:126765951-126765973 AAGGTGCTGTAGAATGAAGGGGG - Intergenic
1197595962 X:128464640-128464662 AAGCAGGTGCTTAATGTAGAGGG - Intergenic
1197636750 X:128923325-128923347 AAGGAGGTACAGAATGCCAAGGG + Intergenic
1197743772 X:129916406-129916428 ACTGAGTTGCAGAATGAAGGGGG - Intronic
1198483251 X:137060500-137060522 GAGGAGGAGGAGAAAGAAGAGGG - Intergenic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198963164 X:142203812-142203834 GAGGATGTGGAGAAAGAAGAGGG + Exonic
1199393141 X:147305485-147305507 AAGGAGGTGGAGCAAGATGATGG + Intergenic
1199407518 X:147479834-147479856 AAGGAGGTCAAGTATAAAGATGG + Intergenic
1199466720 X:148146308-148146330 GAGGAAGTGCAGAATGCAGATGG + Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1199717864 X:150519055-150519077 AAGGAGGAGGAGAAAGAAGGAGG + Intergenic
1199751573 X:150824242-150824264 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200044664 X:153394996-153395018 AGGCAGGCGCAGAATGAAGTGGG - Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1201739754 Y:17311286-17311308 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1202042860 Y:20703227-20703249 AAGGAGGTACAGAAAGAAATAGG + Intergenic