ID: 1011759460

View in Genome Browser
Species Human (GRCh38)
Location 6:90545684-90545706
Sequence TAGCTGTGTCTGCCACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011759460 Original CRISPR TAGCTGTGTCTGCCACAGAT GGG (reversed) Intronic
900457221 1:2783164-2783186 CAGCCATGTCTGCCACAGACAGG - Intronic
902045047 1:13517961-13517983 TGTCTGTGTCTGTCTCAGATGGG - Intergenic
902643540 1:17781863-17781885 TAGCCCTATCTGCCAGAGATGGG - Intronic
903248093 1:22031633-22031655 TAGCTGTGTCTGTGACAGGCAGG + Intergenic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
907966063 1:59331036-59331058 TCTCTGTGTCTGGCACATATAGG + Intronic
918211692 1:182357166-182357188 TAGCCCTGTCTGCCATAAATAGG - Intergenic
918318075 1:183339844-183339866 GAGCTATGTCTGCCTCAGGTGGG + Intronic
923067512 1:230532287-230532309 TATCAGTGTTTGCCACAAATTGG - Intergenic
923397823 1:233584408-233584430 TAGCTTTGCCATCCACAGATGGG - Intergenic
924114381 1:240730703-240730725 TAGGGGTGTCTGACACAGACAGG + Intergenic
924457153 1:244228021-244228043 CAGCTGAGCCTGGCACAGATAGG - Intergenic
1064122639 10:12633184-12633206 TAGTTGTGGCTGCCACACTTTGG + Intronic
1067056603 10:43056252-43056274 GAGCTGTGTCTGTCACACATGGG - Intergenic
1067084712 10:43231644-43231666 CATCTGTGTCAGCCAGAGATGGG - Intronic
1069821786 10:71232987-71233009 CAGCTGTGTCTGCACCTGATGGG + Intronic
1069870218 10:71528500-71528522 AAGCTGTGTCTGCCGCAGGCCGG - Intronic
1070056998 10:72945095-72945117 AAGCAGTTTCTGCCACAGTTTGG + Intronic
1070418782 10:76215369-76215391 TAGCAATGTCTGCCAGATATGGG - Intronic
1072240233 10:93489249-93489271 TGGCCATGTCTGCCACAAATGGG - Intergenic
1072727556 10:97823935-97823957 CGGCGGTGTCTGGCACAGATGGG + Intergenic
1073435255 10:103512429-103512451 TGGCTCTGCCAGCCACAGATAGG + Intronic
1076693606 10:132236466-132236488 CAGCTGTGTCTGCCACGTGTGGG + Intronic
1077451898 11:2653467-2653489 CAGCTGTGTCTGAAACAGCTGGG - Intronic
1080025141 11:27605347-27605369 TAGCTGTATCTGCCTCAGGAAGG - Intergenic
1081345633 11:41982230-41982252 CAGCTGTGTCTTCAACAGCTTGG + Intergenic
1085709476 11:78816059-78816081 TGGCTGTGTCAGTCACAGAGCGG - Intronic
1085736679 11:79045236-79045258 TACCTGTGCCTCCCACAGAGAGG - Intronic
1086915429 11:92524688-92524710 TAACAGTGTATGCCACAGACAGG + Exonic
1088841542 11:113631463-113631485 TACCTGTGTTAGCCACATATGGG - Intergenic
1090034826 11:123239777-123239799 TAGCTGCTTCTGCCGCAGACTGG + Intergenic
1090812509 11:130258549-130258571 TAGCAGTGTCTGCCACAAGTAGG - Intronic
1091863752 12:3811228-3811250 TAGCTGTGTGTGCTGCAGAGGGG + Exonic
1092142503 12:6193583-6193605 TAGGGGTGGCTGCCACAGATTGG + Intergenic
1096737761 12:53669210-53669232 GAGCTGGGGCTGCCACAGTTGGG - Exonic
1098389501 12:69954115-69954137 TAGCTGTATCTGCCACTTATAGG - Intronic
1101049564 12:100847185-100847207 TCACAGTGTCTGCCACAGAGTGG + Intronic
1103333004 12:120167754-120167776 TAGGAGTGTCTGCCACTAATTGG - Intronic
1103489310 12:121304594-121304616 TAGCAGTGTCTGGCCCACATTGG + Intergenic
1104631738 12:130408482-130408504 GCTCTGTCTCTGCCACAGATCGG + Intronic
1106033266 13:26021434-26021456 TACCTGTGTCTAACACTGATGGG - Exonic
1106869617 13:34004683-34004705 TAGCAGTCTCGGCTACAGATGGG - Intergenic
1107422164 13:40257559-40257581 TACCTGTGAATGCCACAGATAGG + Intergenic
1112873630 13:104007010-104007032 TAGGTCTGTCTGCCTCAGATAGG + Intergenic
1113586290 13:111468316-111468338 TAGCTGTCTCAGCCACACACAGG - Intergenic
1115730548 14:36264592-36264614 TAGCAGTGTCTGCCACAAAATGG - Intergenic
1116461763 14:45184801-45184823 TCGCTGTTACTGCCACAGACTGG + Intronic
1117445429 14:55799655-55799677 AAGCTCTGTCTGCCATAGATAGG + Intergenic
1117704928 14:58455590-58455612 TAGCTTAGTCTGCCAGTGATTGG + Intronic
1118744084 14:68761584-68761606 CAGATGTGCCTGCCACAGGTGGG + Intergenic
1120652200 14:87148275-87148297 TAGCTGTGTTTGTAACACATTGG - Intergenic
1122460399 14:101889644-101889666 GAGCTGGGTCTGTCGCAGATGGG + Intronic
1125936478 15:43640757-43640779 TAGCTGTGTGAGCCCCAGAGTGG - Intronic
1125949246 15:43737269-43737291 TAGCTGTGTGAGCCCCAGAGTGG - Intergenic
1129300980 15:74625331-74625353 TCAGTGTGTCTGCCACAGAAAGG - Intronic
1130351919 15:83100290-83100312 TGCCTGTTTCTGCCACAGAGGGG - Intergenic
1130443723 15:83979187-83979209 TAGCAGTGGCTGCTACAGATCGG - Intronic
1132146655 15:99433375-99433397 TAGCTGTCCCCGCCACAGCTGGG + Intergenic
1133589369 16:7227767-7227789 TTCCTGTGTCTGCCACAGGAAGG - Intronic
1135185988 16:20316336-20316358 GAGATGTGTCTGCAACACATGGG + Intronic
1137984644 16:53097665-53097687 TAACTGTGTGTGGCACAGAGAGG + Intronic
1138610274 16:58117896-58117918 CATCTGTGTGTGGCACAGATGGG - Intronic
1139134223 16:64182057-64182079 CAGCTGTGTCTTTCACAGAGAGG - Intergenic
1139681055 16:68563572-68563594 AAGCTGTGTCTTCCAGAGAAAGG - Exonic
1143872820 17:9969788-9969810 ATGCTGTGTGGGCCACAGATGGG + Intronic
1143880714 17:10027617-10027639 TTGCTGTGTCTGCCAGATAAAGG - Intronic
1146957984 17:36948107-36948129 TAGCAGTGCCTGCCACATAGTGG + Intergenic
1151241132 17:72758767-72758789 CAGCTGTGGCTTCCACAGGTGGG - Intronic
1152103872 17:78317891-78317913 TAGCTGTGGCTGCCAGAGGAGGG + Intergenic
1152836200 17:82533827-82533849 TAGCTGGGCCTGGCACAGCTAGG + Intronic
1153195485 18:2591444-2591466 TGGCTGTGTCTGTCCCACATGGG + Intronic
1153228349 18:2914389-2914411 GAGCTGTGTCTGCTGGAGATTGG - Exonic
1153500304 18:5742448-5742470 TATGTGTGGCTGCCACAGATTGG + Intergenic
1154247402 18:12711411-12711433 TACATGTGTTTGTCACAGATAGG + Intronic
1156352867 18:36315957-36315979 TGGCTGTCTCAGCCACAGAACGG - Intronic
1158183292 18:54742529-54742551 TTGCTATGTCTGCAATAGATTGG + Intronic
1158950583 18:62491177-62491199 TAGCTGTGCTGGCCACTGATTGG - Intergenic
1159380507 18:67651376-67651398 TCCCTGAGTCTGCCACACATTGG - Intergenic
1160266194 18:77342264-77342286 CAGCTGTGCCTGCCCCAGGTCGG + Intergenic
1160862753 19:1244647-1244669 GAGCTGTGGCTGCCACCCATGGG + Exonic
925282152 2:2692069-2692091 GAGATGTGTCTGTCACAGAGTGG + Intergenic
925465269 2:4102416-4102438 CAGCTGTTTATGCCACAGATTGG + Intergenic
927202531 2:20587376-20587398 TTGCTCTCCCTGCCACAGATGGG - Intronic
929793737 2:45042271-45042293 AGGCTTTGTCTGCCACAGACTGG + Intergenic
930092838 2:47543891-47543913 TAGCTACTTCTGCCACTGATGGG + Intronic
930417432 2:51106327-51106349 TAGCAGTATCTGCCACACTTAGG + Intergenic
931613780 2:64133534-64133556 TAGCTGTATCTGCCATGGGTTGG + Intronic
932125807 2:69144636-69144658 TAGCTTTCTCTGCCAGAAATAGG - Intronic
935511127 2:103975540-103975562 TAGCTGCTTTTGCCACAGAGGGG - Intergenic
936243768 2:110809189-110809211 GAGCAGTGTCTGCGACAGAGAGG - Intronic
936532782 2:113288503-113288525 TAGCTGTGCCTGCCCCTCATTGG + Intergenic
938966105 2:136389933-136389955 TAGCTATGTCTGTCAAAGGTGGG + Intergenic
942515655 2:176750173-176750195 TAGCTGTGTATGGGACAGAAAGG - Intergenic
942907357 2:181199958-181199980 TACCTGTGTATACCACAGACTGG - Intergenic
945762737 2:213934558-213934580 TAACAGTCTCTGCCACAGTTTGG - Intronic
947042962 2:225944994-225945016 TAGCTGCTTCAGCTACAGATGGG - Intergenic
947277977 2:228416374-228416396 TAGATGTGTCTGCCAAAAACTGG - Intergenic
947887714 2:233587942-233587964 CAGTTGTGTCTCTCACAGATTGG + Intergenic
948869333 2:240790392-240790414 AGGCTGTGTCTGCCCCGGATTGG + Intronic
1170569779 20:17626172-17626194 TAGATGTGTCTGGCAGAAATTGG - Intronic
1170690777 20:18613323-18613345 TGGCTGTTTCTGCCACAGCGTGG + Intronic
1171189531 20:23149399-23149421 CAGCTGTGTCCACCACAGCTGGG - Intergenic
1172828261 20:37808766-37808788 TAGCTGTGTCAACCAGAGGTAGG - Intronic
1173554607 20:43956686-43956708 TAGCTGTGTCTGCCTAAGAGTGG + Intronic
1173923383 20:46762434-46762456 TTGCTGTGTCTGGCACCCATGGG - Intergenic
1174058723 20:47817320-47817342 CAGCAGTCTCTGCCACAGCTGGG - Intergenic
1174660044 20:52204462-52204484 TAATTGTCTCTGCCACAGAAAGG + Intergenic
1175574440 20:60050304-60050326 TAGCTATGTGAGCCACAGGTAGG - Intergenic
1175983685 20:62753878-62753900 TGGCTGTGACTTCCCCAGATGGG - Intronic
1178862309 21:36299625-36299647 TAGCGGTGTCTGGCATATATAGG + Intergenic
1180195771 21:46192710-46192732 TGTCTGTGTGTGGCACAGATGGG + Intronic
1180195780 21:46192827-46192849 TGTCTGTGTGTGGCACAGATGGG + Intronic
1180195789 21:46192944-46192966 TGTCTGTGTATGGCACAGATGGG + Intronic
1180195798 21:46193061-46193083 TGTCTGTGTGTGGCACAGATGGG + Intronic
1180195807 21:46193178-46193200 TGTCTGTGTGTGGCACAGATGGG + Intronic
1180195842 21:46193656-46193678 TGTCTGTGTGTGGCACAGATGGG + Intronic
1181278444 22:21702186-21702208 TTCCTGTGTCTGCCACACCTGGG - Intronic
1182501589 22:30751994-30752016 TACCTGTGTCAGTCACAGAGGGG + Intronic
1182709261 22:32310448-32310470 CAGCTGTGGCTGCCCCAGCTGGG + Intergenic
1183147307 22:36005244-36005266 CAGCAGTGTATGCCACTGATTGG - Intronic
1183260997 22:36795807-36795829 TAGCTGTGTCCGGCACAAGTAGG + Intergenic
949254465 3:2029455-2029477 CAGGTGTGTCAGCCACAGAATGG - Intergenic
952111840 3:30133182-30133204 TCACTGTGGGTGCCACAGATCGG - Intergenic
953602926 3:44386345-44386367 TAGCAGTGGCTGCTCCAGATGGG - Intronic
955636235 3:61032659-61032681 TAGCTCTGTTTGCAACAGAGAGG - Intronic
956143038 3:66164849-66164871 TAACTGGATCTGCCACAGAAGGG + Intronic
956623484 3:71244596-71244618 CTGTTGTGGCTGCCACAGATCGG + Intronic
956664655 3:71631166-71631188 TGGCAGTGTGTGCCACAGTTGGG - Intergenic
958938475 3:100284187-100284209 TAGCTGCTTTTGCCACAGAGGGG + Intronic
961418900 3:126784110-126784132 TAGATGTGCTTGCCACAAATAGG + Intronic
962137498 3:132751843-132751865 TAGCTGTGTCTGATAAAGAAAGG - Intergenic
963192888 3:142493167-142493189 TAGCTGTTTCTTCCATAAATCGG + Exonic
967339746 3:188383449-188383471 TAGCATGGTATGCCACAGATAGG + Intronic
968539604 4:1157989-1158011 AAGCTATAGCTGCCACAGATAGG - Intergenic
969265381 4:6061073-6061095 TAGCAGTGTCTCCCTGAGATGGG - Intronic
973884497 4:55306817-55306839 TAGCTGTCTCTGCCACATGGGGG - Intergenic
975793367 4:77980596-77980618 TTGCTAAGTCTGCTACAGATAGG - Intergenic
975856205 4:78627332-78627354 CAGCTCTGCCTTCCACAGATTGG + Intergenic
977562345 4:98545202-98545224 TGGCTGTTTCTGCCACTGCTTGG + Intronic
977771836 4:100869532-100869554 CAGCTGTGTCTGAAACAGGTGGG + Intronic
979162300 4:117478314-117478336 TACCTGTGTCTACCCCAAATAGG + Intergenic
979167853 4:117558971-117558993 CAGGTGTGTCTGCGACAGATGGG + Intergenic
980639394 4:135555922-135555944 TAACTGGGCCTGCAACAGATTGG - Intergenic
984217185 4:176928609-176928631 TCCCTCTGTCTGCCACTGATTGG + Intergenic
985646421 5:1086810-1086832 GTGCTGTGTGTGCCACAGAGTGG + Intronic
986746909 5:10753152-10753174 GAGCGGTGCCTGCCACAGAGTGG - Intronic
986761869 5:10887488-10887510 TAGCTCTCTCTGCCACATTTTGG - Intergenic
989603399 5:43220986-43221008 GAACAGTGTCTGCCACATATTGG + Intronic
990121363 5:52457356-52457378 TTGCACTGTCTGCCACAGTTTGG + Intergenic
991012896 5:61902117-61902139 GAGATGTGTCTGCCAAATATTGG - Intergenic
991399583 5:66239145-66239167 GAACAGTGTCTGCCACACATAGG - Intergenic
994236073 5:97364025-97364047 TAGCTGCTTCTGCCAAAAATTGG + Intergenic
994939938 5:106310193-106310215 TAGATGTTTCTGCAAGAGATGGG - Intergenic
996629529 5:125610857-125610879 CAGCTGTGTCTTTCACAGAGAGG + Intergenic
999014554 5:148086469-148086491 AAGCTGTTTGTGGCACAGATGGG + Exonic
999128537 5:149264983-149265005 TGGCCTTCTCTGCCACAGATTGG + Intergenic
999240936 5:150127010-150127032 TTGCTGGGGCTGCCACAGCTCGG + Intronic
999436492 5:151567477-151567499 TGGCTGTGACTGCCACTGACCGG - Exonic
1001813779 5:174650672-174650694 TAGCAGTCTTGGCCACAGATAGG - Intergenic
1002889759 6:1322376-1322398 CAGCTGTGTCTCACACAGCTGGG + Intergenic
1003992450 6:11499454-11499476 TAGCTGGGTCTGGCACAGAGTGG - Intergenic
1004721280 6:18269570-18269592 TTGCTGTCTCTGACACAGAAGGG + Intergenic
1005622538 6:27633270-27633292 CAGCTGTGTCTGCCACCCAGAGG + Intergenic
1006924680 6:37647938-37647960 AAGCTGTGTATGCCACTGAATGG + Intronic
1006947350 6:37793594-37793616 TAGCAGTCTTTGCCACAGATAGG - Intergenic
1007223164 6:40294740-40294762 GAGCTGTGTCTCCCTCAGACTGG - Intergenic
1007243984 6:40446898-40446920 GAGCTGTGTCTCCCTCAGACTGG + Intronic
1007243992 6:40446936-40446958 GAGCTGTGTCTCCCTCAGACTGG + Intronic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1007740049 6:44004607-44004629 GGGCTGTGTCTGCCTCAGACTGG + Exonic
1007760448 6:44130233-44130255 TATCTGGGTCTACCACAGACTGG + Intronic
1008517493 6:52332002-52332024 TTGCTGCTTCTGCCACAGTTAGG - Intergenic
1009350165 6:62665311-62665333 TAGCAGTGTCCGCCAGAGATAGG + Intergenic
1010793185 6:80088984-80089006 TAAATGTCTCTGCCACAGGTGGG + Intergenic
1011195871 6:84778789-84778811 TAGCTGTCTCTGCCAAACAATGG - Intergenic
1011629500 6:89310509-89310531 TAGGTGAGTCTGCCAAAGAGAGG - Intronic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1012125967 6:95428480-95428502 TAGCAGTGGCTGGCACAGCTGGG - Intergenic
1014622299 6:123683334-123683356 AACCTGGGTCTGCCTCAGATAGG - Intergenic
1016244246 6:141964172-141964194 CAGATTTGTTTGCCACAGATTGG + Intergenic
1016778356 6:147930863-147930885 TAGCTGTGCCTGCAGCCGATTGG + Intergenic
1020703883 7:11517924-11517946 GAGTTGTGAGTGCCACAGATAGG + Intronic
1020839149 7:13193298-13193320 TAGCTGTGCCTGGGACAGAGAGG - Intergenic
1022702458 7:32774711-32774733 TAGCTGTTTATGCCACAGTGGGG - Intergenic
1022906690 7:34864844-34864866 TAGCTGTTTATGCCACAGTGGGG - Intronic
1024583853 7:50823978-50824000 TAACTGTGTCCCCCAAAGATAGG - Intergenic
1029234758 7:99105742-99105764 TGGCTGTGTGTGTCACAGAGGGG + Intronic
1031037133 7:116799903-116799925 TAGCAGTGTCTGACATATATAGG - Intergenic
1031910943 7:127516084-127516106 CAGCAGTCTCTGCCACAGTTGGG - Intergenic
1033242180 7:139689662-139689684 AAGCTGTGTGTGGCAGAGATGGG - Intronic
1035817602 8:2557840-2557862 GAGCATTGTCTGCCACAGATGGG - Intergenic
1036372149 8:8170945-8170967 TAGTTGGGTCTCGCACAGATGGG - Intergenic
1036878752 8:12494696-12494718 TAGTTGGGTCTCGCACAGATGGG + Intergenic
1037150635 8:15631293-15631315 TAGGTGTCTCTTCCTCAGATAGG + Intronic
1037741830 8:21614575-21614597 TTGCAGTGTCTGCCGCAGACAGG - Intergenic
1040620521 8:49086745-49086767 TAGTTTTATCTGCCACAAATTGG + Intergenic
1042937917 8:74079111-74079133 TAGCTGGGCCTTCAACAGATTGG - Intergenic
1043304047 8:78771815-78771837 TAGCAGTGGCTGCAACAGAAAGG - Intronic
1043405846 8:79932113-79932135 GAGCAGTATCTTCCACAGATGGG - Intronic
1044926489 8:97213664-97213686 TTGCCTTGTCTGCCACACATTGG - Intergenic
1046488958 8:114922295-114922317 CAGCTGTGTTTGCCACAGCCAGG + Intergenic
1047563488 8:126014188-126014210 TAGCACTGTCTGCTACAGTTGGG + Intergenic
1051358980 9:16265321-16265343 TAACTGTGTCTGCAACAGCCTGG + Intronic
1056210151 9:84357768-84357790 TAGCTGTGTGACCCACAGCTCGG - Intergenic
1056814180 9:89789713-89789735 TGGCTGTGTCTCCCACTGAGGGG - Intergenic
1057973099 9:99576082-99576104 CATCTGTGTATGCCACAGGTGGG - Intergenic
1058199063 9:102016025-102016047 TATCAGTGACTGCCACAGATAGG + Intergenic
1060152176 9:121295736-121295758 TCTCTGTGTCTGCCACAGGATGG - Intronic
1060388795 9:123259885-123259907 TAGCTGTGTTTGGCACAAATAGG - Intronic
1060396883 9:123322571-123322593 TCCCAGTGTCTGGCACAGATAGG + Intergenic
1060898683 9:127238290-127238312 TAGCTGTGGCAGCCACAGCCAGG - Intronic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061946082 9:133908746-133908768 TAGCTGCGTCTGCCTCAGAGGGG - Intronic
1062250217 9:135590084-135590106 GAGCTGTCCCTGCCACACATAGG + Intergenic
1188930784 X:36108599-36108621 TGGCTGTGTGAGCAACAGATGGG - Intronic
1189807223 X:44748020-44748042 TAGCTGTATCTGTCATAAATAGG - Intergenic
1192019102 X:67365295-67365317 TAGCAGTCTCTGCTACAGGTGGG + Intergenic
1192268548 X:69557062-69557084 CAGCTGTGTGTGTCACAGAAGGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1193880425 X:86914251-86914273 AAAGTGTGTCTGCCACACATTGG - Intergenic
1198619559 X:138491040-138491062 TAACTGTGTTTGCCAGAGAGAGG - Intergenic