ID: 1011759583

View in Genome Browser
Species Human (GRCh38)
Location 6:90547377-90547399
Sequence TAATTTTAACAGAGTGAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011759583_1011759585 24 Left 1011759583 6:90547377-90547399 CCAGATTCACTCTGTTAAAATTA 0: 1
1: 0
2: 2
3: 39
4: 332
Right 1011759585 6:90547424-90547446 TCTTTAGATTTAGCAATCTTAGG 0: 1
1: 0
2: 1
3: 19
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011759583 Original CRISPR TAATTTTAACAGAGTGAATC TGG (reversed) Exonic
902353403 1:15876890-15876912 TAATTTTAATACTGTGCATCTGG - Intronic
902914866 1:19631254-19631276 TAATTTAAACTCAGTGAAACTGG - Intronic
903097918 1:20997253-20997275 TAAATTTAACTGAATGAAGCAGG - Intronic
904791233 1:33023174-33023196 TAATTATAACTGAGTTATTCTGG - Intronic
904844926 1:33403692-33403714 TAATTTTAGCAGAGTGGAGATGG - Intronic
905423830 1:37867429-37867451 GAATTTGAATACAGTGAATCTGG - Intronic
905845448 1:41227364-41227386 AAATTTAAACAGAGTGACTATGG - Intronic
906553787 1:46690421-46690443 TAATTATAACAGAATGCAACTGG + Intronic
906558984 1:46740332-46740354 TAATTTTTTCAGATTGAATGGGG + Intergenic
906592357 1:47038041-47038063 TAATTAAAACAGTGTGATTCTGG - Intronic
907746925 1:57222925-57222947 GAATTGTAACACACTGAATCTGG + Intronic
907806094 1:57821807-57821829 TTTTTTTAAGAGAGTGAATTTGG + Intronic
908841674 1:68286148-68286170 TTATTTTAAAAGAATAAATCAGG - Intergenic
909256038 1:73423285-73423307 TAATTATAAGAGAATGCATCTGG + Intergenic
909613582 1:77580470-77580492 TAATTTTAAAAGAAGGAACCTGG - Intronic
911198628 1:95021236-95021258 AAATTTTGAAAGAGTAAATCTGG - Intronic
911908787 1:103604469-103604491 TAATTTCAACAGTGTCAATAAGG - Intergenic
911914130 1:103674992-103675014 TAATTTCAACAGTGTCAATAAGG + Intronic
912138845 1:106696595-106696617 TAATTCTAACTGGGTCAATCTGG - Intergenic
912565025 1:110581367-110581389 TCATTTTAACTGAGTGTATTTGG - Intergenic
913035339 1:114959520-114959542 TAATTTTATCAGAGTGAATGAGG + Intronic
916542121 1:165767024-165767046 TAATTTTAAAAGCCTGAGTCTGG + Intronic
917775934 1:178334512-178334534 TATTTTTAATAGATAGAATCAGG + Intronic
919040370 1:192379703-192379725 TAAATCTAAAAGAGTGAGTCAGG - Intergenic
920016689 1:202916664-202916686 TAGTTTTAACAAAATAAATCAGG + Intronic
923635058 1:235687339-235687361 TAAATTTAACAAAATGATTCAGG + Intronic
923836651 1:237618293-237618315 GTAGTTTAACAGAGTTAATCTGG - Intronic
924186143 1:241493543-241493565 TGATTTTAAGAGGGTGAAACAGG - Intergenic
924329013 1:242923857-242923879 TAATGCTAACAGAGTGAGTGGGG - Intergenic
1062870912 10:903367-903389 AAATTATAAAAGATTGAATCAGG - Intronic
1064445669 10:15390619-15390641 GCCTTTTAACCGAGTGAATCAGG + Intergenic
1065225150 10:23536025-23536047 CAATTTTAATAGAGTAAATTTGG + Intergenic
1066239344 10:33518177-33518199 TGATGTTAACAGAGTGACTTTGG - Intergenic
1067380897 10:45772367-45772389 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067380899 10:45772414-45772436 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067864260 10:49886859-49886881 TATTTTTAACAGAGTTAAAGAGG - Intronic
1067888597 10:50113021-50113043 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067888599 10:50113066-50113088 GCACTTTAAAAGAGTGAATCTGG + Intronic
1068353481 10:55880749-55880771 TAATTGTTACATAGTGAAACAGG + Intergenic
1068961466 10:62870795-62870817 TACTTTTAAAAAAGTGAATTAGG - Intronic
1070020081 10:72576379-72576401 TAAGAATAAAAGAGTGAATCAGG + Intronic
1070221381 10:74449283-74449305 TACTTTCAACTGATTGAATCAGG + Intronic
1070395734 10:76009996-76010018 TAATTATAACAGAGAGAAGGCGG - Intronic
1071412322 10:85408977-85408999 GAATTTTAAAACAGTGAAACAGG - Intergenic
1072829644 10:98644288-98644310 TAATCTGAACAGAGTAGATCTGG - Intronic
1075240080 10:120770400-120770422 TTATTTTAACACTGTGTATCTGG - Intergenic
1076216168 10:128695149-128695171 AATTTTTAACAGAATGAATGTGG + Intergenic
1076755195 10:132566728-132566750 TAATTTTAAAACACAGAATCAGG + Intronic
1077452593 11:2658339-2658361 TAATTTTATCAGTGTGGATTTGG + Intronic
1079330119 11:19526183-19526205 TGATTAAAACACAGTGAATCAGG - Intronic
1079609534 11:22414783-22414805 TATTTTTAACTGAATGAATAAGG - Intergenic
1079776596 11:24539151-24539173 TAATTTTAAAACATTGGATCTGG + Intronic
1081188413 11:40073699-40073721 TAATTTTAAGTGAGTGGATAAGG - Intergenic
1083075229 11:60029908-60029930 TAATTTTAACAGTGTTAATAAGG + Intergenic
1085486558 11:76868711-76868733 TAATATTAATAGACTGAATGGGG - Intronic
1085840401 11:80005095-80005117 TAATTTTAACTGAAAGAATCCGG - Intergenic
1087020370 11:93596442-93596464 TAATGTTAGCAGAGTGAGTAGGG - Intergenic
1087282799 11:96231173-96231195 TAATTTTACCTGTGGGAATCAGG - Intronic
1087302811 11:96455810-96455832 TAATTCTAGCAGAGTGATACGGG - Intronic
1089039803 11:115436120-115436142 TTATTTTAACAGGGTGAAGTGGG - Intronic
1089369268 11:117942635-117942657 TAATGCTAACAGAGTGAGTATGG - Intergenic
1089801718 11:121036279-121036301 GAATTTTACCAGATCGAATCTGG + Intronic
1089894575 11:121917023-121917045 TAATTAGAAAAGTGTGAATCGGG + Intergenic
1090603737 11:128399673-128399695 TACCTTTAGCAGAGTGAAGCTGG - Intergenic
1092085367 12:5753486-5753508 TCATTTTGGCAGAGTGAATTGGG + Intronic
1092319689 12:7459362-7459384 TAATTAAAACAGAGTGGTTCTGG + Intronic
1094554020 12:31480180-31480202 TAATTATAAATGAGTGAAACTGG + Exonic
1094795159 12:33963509-33963531 CAATTTCCACAGATTGAATCGGG - Intergenic
1095119575 12:38400911-38400933 TGATCTTAACAGATAGAATCAGG - Intergenic
1095180193 12:39138343-39138365 GAATTTTACCAGAGAGAATCAGG + Intergenic
1095545557 12:43363771-43363793 GAAGTTTAACAGAGAGAATCAGG + Intronic
1095781625 12:46066583-46066605 TAATTTCAACAGTGTGTCTCAGG - Intergenic
1095803265 12:46291547-46291569 TAATTTAACAAGGGTGAATCAGG + Intergenic
1097156924 12:57018703-57018725 TAATGTTAACAGACTGAGTGGGG - Intronic
1097157330 12:57022476-57022498 TAATGTTAACAGACTGAGTGGGG - Intronic
1097931436 12:65191518-65191540 TAAATTTAACATACTGAATAAGG + Intronic
1099426191 12:82525823-82525845 TCATGTTAACAAAGTGAATCAGG - Intergenic
1100575269 12:95885744-95885766 TAATTTTAGCAGTGTTAATTAGG + Intronic
1100594139 12:96057015-96057037 TAAATTTAACAGAGTTTATTTGG - Intergenic
1100758600 12:97780156-97780178 TAATTTTATCAGTGTGAAATAGG + Intergenic
1102107885 12:110341396-110341418 TAAATTTAACATAATGTATCTGG - Intronic
1102786155 12:115606578-115606600 TAATTCTAATCGGGTGAATCTGG - Intergenic
1103242319 12:119423840-119423862 TTATTTTAACATACTGGATCAGG - Intronic
1105052035 12:133063332-133063354 TATTTCTAACAGAGGAAATCAGG + Intergenic
1105333703 13:19443123-19443145 AAATATTAACAGACAGAATCTGG + Intronic
1106741365 13:32646538-32646560 TAAATACCACAGAGTGAATCTGG + Intronic
1107732879 13:43365959-43365981 TAATTTTAACCCAGTAATTCTGG - Intronic
1109909238 13:68888894-68888916 TAATTTAAAAAGAGTGACTGGGG + Intergenic
1109945964 13:69432626-69432648 TAATTTTAGCAAAGTAAAACAGG + Intergenic
1110260905 13:73484298-73484320 TAATTTTAACACTCTGAATGTGG - Intergenic
1110608641 13:77463542-77463564 TAATTGTAACACATTGAATATGG - Intergenic
1112808450 13:103188399-103188421 TATTTTTAACACAGAGAACCCGG - Intergenic
1113712005 13:112471726-112471748 TAATTTTAACATATGGAATGAGG - Intergenic
1114034028 14:18604512-18604534 TAATTTTTGAAGAGTGAAACAGG + Intergenic
1114078824 14:19183686-19183708 TAATTTTTGAAGAGTGAAACAGG + Intergenic
1114124617 14:19710498-19710520 TAATTTTTGAAGAGTGAAACAGG - Intergenic
1115988226 14:39125015-39125037 TATTGTTAGCAGAATGAATCAGG + Exonic
1116029999 14:39560123-39560145 AAAATTTAACAGAGAGAACCAGG - Intergenic
1116171909 14:41413704-41413726 TGATGTTAACAAAGTGACTCAGG + Intergenic
1117576073 14:57099431-57099453 TAACTTTAACAGAATGAAGGGGG + Intergenic
1118107643 14:62678398-62678420 TAATTTTAATGCAGTCAATCTGG + Intergenic
1119558995 14:75575243-75575265 AATTTCTAACAGAATGAATCAGG - Intergenic
1119587388 14:75849340-75849362 TAAATTCAACAGAGAGAATAAGG - Intronic
1120270482 14:82307849-82307871 TACTTTTATCTGAGTGAAACAGG - Intergenic
1121475437 14:94196903-94196925 TAATTTTTAAAGAGAGAATAAGG - Intronic
1123510845 15:20998027-20998049 TAATTTTTGAAGAGTGAAACAGG - Intergenic
1123568065 15:21571784-21571806 TAATTTTTGAAGAGTGAAACAGG - Intergenic
1123604173 15:22007108-22007130 TAATTTTTGAAGAGTGAAACAGG - Intergenic
1124571069 15:30864323-30864345 TATTTTTAACCAAGTAAATCAGG + Intergenic
1124926700 15:34076982-34077004 TCATTTTTCCAGAGAGAATCAGG + Intergenic
1125204845 15:37142143-37142165 TAATTTTAAGAGGTTGAATATGG - Intergenic
1125853598 15:42927580-42927602 TAATATTTACAGAGTGAAGAAGG - Intergenic
1125915582 15:43484445-43484467 GATTTTTAACAGAGTCACTCTGG - Intronic
1126537922 15:49787286-49787308 AAATTTTAACAGATTAAATCTGG - Intergenic
1127333972 15:57965770-57965792 TAATTTGAAGAGAGTAACTCTGG - Exonic
1128726983 15:69995519-69995541 TAATCTTTACAGAATGAATGAGG - Intergenic
1202976424 15_KI270727v1_random:298874-298896 TAATTTTTGAAGAGTGAAACAGG - Intergenic
1135776683 16:25262687-25262709 TAATGTTAACTCAGTGAAGCAGG + Intergenic
1137281258 16:46978711-46978733 TAATATTAACAGACTGAGTGGGG - Intergenic
1138996573 16:62461032-62461054 TTTTGTTAACAGAGTGATTCTGG + Intergenic
1139131134 16:64147121-64147143 TAATTTAAAAGGAGTTAATCTGG - Intergenic
1140848276 16:78910476-78910498 TCATGTTAGCAGAGTGTATCAGG + Intronic
1143339121 17:6195180-6195202 TTATTTTAACAGAAGGAAGCAGG + Intergenic
1148415471 17:47502990-47503012 TGATTATCACACAGTGAATCAGG + Intergenic
1149178004 17:53898000-53898022 TTATTTTTAAAGAGTGACTCTGG - Intergenic
1149277174 17:55054827-55054849 TAATTTTAACTGAGGGCATAAGG + Intronic
1150057482 17:62031988-62032010 TAAGTTTAACAAAGGTAATCTGG + Intronic
1153158166 18:2172556-2172578 TAAGTTTGACAGTGAGAATCAGG - Intergenic
1153384876 18:4480936-4480958 TATTTTTATCAAAGTGAATGAGG - Intergenic
1153387537 18:4514971-4514993 TGATTTTAATAGGGTGAATATGG + Intergenic
1154087109 18:11317533-11317555 TAATTTTGGCAGAGTGAATTGGG + Intergenic
1155373931 18:25135635-25135657 TAATTTTAACAGAGTGTGTGTGG + Intronic
1155441492 18:25867184-25867206 TAATGTTACCAGTGAGAATCTGG + Intergenic
1155669711 18:28355560-28355582 AAATTTGATCAGTGTGAATCTGG - Intergenic
1155704735 18:28794580-28794602 TAATTTTTAATGAGTAAATCAGG - Intergenic
1155946154 18:31853935-31853957 TTTTTTTGACAGAGTGAAGCAGG - Exonic
1156024988 18:32642909-32642931 TAATTTTCAAATACTGAATCAGG + Intergenic
1156189255 18:34699398-34699420 TAATTTTAACAGATTGGATTAGG + Intronic
1158061651 18:53349948-53349970 TAATTTTAAAAAACTGAATTTGG + Intronic
1158148024 18:54337925-54337947 GAAGTTTAACAGAGAGAAGCAGG + Intronic
1158283889 18:55857238-55857260 CAACTTTAACAGAGGAAATCTGG + Intergenic
1158841282 18:61390600-61390622 TAATTAAAACAGCGTGAATCTGG + Intronic
1159397527 18:67881974-67881996 TGTTTTTAACAGAGACAATCAGG + Intergenic
1159648095 18:70943404-70943426 TTCTTTTAAGAGAGAGAATCAGG + Intergenic
1159653372 18:71003590-71003612 TAATTTTAACGTAGTGGCTCAGG - Intergenic
1159715143 18:71812343-71812365 AAATCATAACAGAGTGAAACTGG + Intergenic
1160261279 18:77296508-77296530 AAATTTTAACACAGTGAAAAAGG + Intergenic
1161151568 19:2712886-2712908 TAATGTGCACAGAGTGAATCTGG + Intergenic
1162869516 19:13574960-13574982 TAAATTTAACAAACTGAAGCTGG - Intronic
1163532153 19:17856402-17856424 TAATTTTAAAAGATTGCATAAGG + Intergenic
1163868598 19:19797471-19797493 TAATTTTCACAAAGTGAAACAGG + Intronic
1164290017 19:23859125-23859147 TAGTTTTAACATAATGAAGCAGG - Intergenic
1164425784 19:28140326-28140348 TTCTTTTGACAGAGTGAATTGGG - Intergenic
1164993376 19:32700729-32700751 AAATTTTAAAAGACTGAAACTGG - Intronic
1166674743 19:44733081-44733103 TAAATTTAAGATAGTGAATCTGG + Intergenic
1166896826 19:46028495-46028517 TAATTGTAACAGATTAAATCAGG - Intergenic
1168586416 19:57597360-57597382 TAATTTTAACAAATTGAATTTGG + Intergenic
925514232 2:4662449-4662471 TATTTTTATGAGAGTGAATTTGG + Intergenic
926351144 2:11995908-11995930 TAATTTAAAAAGTGTGAAACAGG - Intergenic
926788758 2:16547936-16547958 TAATTTTAAAAGAGTGTCTTTGG - Intergenic
928150306 2:28821725-28821747 TAATTTGAACAGACAGAACCTGG + Intronic
929347823 2:40908133-40908155 GAAGTTTAACAGAGGAAATCAGG - Intergenic
930433375 2:51310049-51310071 GAGGTTTAACAGAGAGAATCAGG + Intergenic
931901200 2:66790206-66790228 TGATTTTAAGAAAATGAATCTGG + Intergenic
932531637 2:72540382-72540404 AAATATTAACAACGTGAATCTGG - Intronic
933284587 2:80371906-80371928 TGATTTTCACAGAGTGAAACTGG + Intronic
935899890 2:107780122-107780144 TAATTTAAAAAGAGAAAATCAGG + Intergenic
936262177 2:110970243-110970265 AAATATTAACAAATTGAATCTGG + Intronic
936695295 2:114939455-114939477 TAATTTAAACAATGTGAAACAGG - Intronic
936707189 2:115088601-115088623 TAATTTTAAAAAAATCAATCAGG - Intronic
939214519 2:139218946-139218968 GCATTTTATCAGAGTGAATGGGG + Intergenic
939417551 2:141920169-141920191 TAATTTTAATAGACTGAGTTCGG - Intronic
939819551 2:146939723-146939745 TAACTTTAAAAGTGTGAATTAGG + Intergenic
939995981 2:148920519-148920541 TAATTTTAGCAGAATGACTCTGG + Intronic
940092143 2:149932613-149932635 TAATCTTAAAAGAGTGAACATGG - Intergenic
940361001 2:152795495-152795517 TAAGTTTAACTGATTGACTCTGG - Intergenic
941405631 2:165084076-165084098 AAAGTTTAACAGAGTGAACCAGG - Intergenic
941493638 2:166173781-166173803 TAATTTTCCCAAAGTAAATCTGG - Intergenic
941909830 2:170754074-170754096 AAATTTTAGCAGATTGCATCTGG + Intergenic
943673002 2:190684621-190684643 TGATTTTTACATTGTGAATCAGG + Intronic
944365091 2:198909449-198909471 TTATTTTAATTGAGTGAATTTGG - Intergenic
944870370 2:203905137-203905159 TAAACTTAACAGAGTTAATCAGG - Intergenic
945543643 2:211121653-211121675 TTATTTTAACATAGAGAATATGG + Intergenic
945690524 2:213029056-213029078 AAATTTTAACACATTGAATCTGG - Intronic
1169441428 20:5636973-5636995 TAATGTTAATAGACTGAATGAGG + Intergenic
1169725917 20:8730837-8730859 TATTTTTAACAGATTGTTTCTGG + Intronic
1170234172 20:14083571-14083593 GGATTTTAACAGAGTCAGTCTGG + Intronic
1171033452 20:21697143-21697165 TGATTTGGGCAGAGTGAATCAGG - Intergenic
1174074965 20:47927979-47928001 TTAATTTAACAGAGTTAATAGGG - Intergenic
1176924339 21:14729016-14729038 TAGTTGTGACAGAGAGAATCTGG - Intergenic
1177034813 21:16028436-16028458 TAGTTTTAACTGAGTGGTTCTGG - Intergenic
1177567874 21:22847283-22847305 TAATTTTAACAGAGGGCTTATGG + Intergenic
1180458147 22:15531555-15531577 TAATTTTTGAAGAGTGAAACAGG + Intergenic
1180657069 22:17430919-17430941 TAAAACTAACAGAGTTAATCTGG - Intronic
1181130413 22:20728088-20728110 TAACTTTAAAAGAGTGTAACTGG + Intronic
1181566309 22:23740799-23740821 GAATTTGAACAGAGGGAATGAGG + Intergenic
1183900433 22:41001914-41001936 AACTTTGAACAGAGTGAATCTGG + Intergenic
1183963634 22:41428205-41428227 TAATAATAATATAGTGAATCAGG + Intergenic
1184312895 22:43659676-43659698 TTATGGTAACAGAGTGAATTAGG - Intronic
949220352 3:1625625-1625647 TAATTTTGAAAGAGTGTAACTGG + Intergenic
950475623 3:13213236-13213258 CACTTTTAAAAGAATGAATCTGG - Intergenic
951038261 3:17958594-17958616 AAATATTAGCAGACTGAATCCGG - Intronic
951173690 3:19574304-19574326 TAATTTTGACAGATTGTATTTGG - Intergenic
951796662 3:26546456-26546478 TAAATTTAACAGAGTCTATTTGG - Intergenic
951932767 3:27987401-27987423 TAAATTTAAAACAGTGAACCAGG - Intergenic
952611868 3:35219834-35219856 TTATTTTACCAGAGAGAATCAGG - Intergenic
952793785 3:37221036-37221058 TAATTGTAACACAGTGTCTCAGG + Intergenic
953455710 3:43040352-43040374 TAATTCAAACAGTGTGACTCTGG - Intronic
953684932 3:45069837-45069859 TAATTTTAGCAGAGTGGAGATGG + Intergenic
957761551 3:84564636-84564658 TTATTTTAACACAGAGAATCAGG - Intergenic
958106572 3:89081397-89081419 CTATTTTGACTGAGTGAATCTGG - Intergenic
958706416 3:97662237-97662259 AAATTTTAAAAGTGGGAATCAGG - Intronic
960093197 3:113662926-113662948 TCATTTTAACATAGGGAAACTGG + Intronic
962075607 3:132078637-132078659 AAGTTTGAAGAGAGTGAATCAGG - Intronic
962085253 3:132184500-132184522 TATTTCTTAAAGAGTGAATCGGG + Intronic
962461811 3:135621224-135621246 TACTTTTAAAAGAGTGACTCAGG - Intergenic
964016969 3:151959838-151959860 ACATCTTAAGAGAGTGAATCAGG + Intergenic
964080677 3:152752290-152752312 TAATTTTAAAAAAGAGAAACTGG + Intergenic
964095616 3:152927837-152927859 TAATTCTTGTAGAGTGAATCTGG - Intergenic
964842418 3:161008336-161008358 TAATTCTAATAGATTGAATGGGG - Intronic
965107037 3:164369537-164369559 TAATTTTAACTGAGATAATAAGG + Intergenic
965822286 3:172696864-172696886 TAAGTTTAACAGAGTTAATCAGG - Intronic
966392998 3:179472851-179472873 TCATTTTCAAAGAGTGAATTTGG - Intergenic
967524861 3:190479979-190480001 TAATATTAACACAGTGAAGAGGG + Intergenic
967898660 3:194423842-194423864 TAATTCTAACAGTGTGGATAGGG + Intronic
971587502 4:28423137-28423159 TAATTTTAACATAGCAAATAAGG - Intergenic
972009743 4:34162576-34162598 TAATTGTAACATACTGAATGGGG + Intergenic
972012640 4:34204280-34204302 TAATTTCTACTGAGTGGATCAGG + Intergenic
972181459 4:36471913-36471935 TATTTTTACCAAAGTGAATAAGG - Intergenic
972674463 4:41246072-41246094 TAATTTTACCAGGGTGGAGCTGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973904018 4:55508362-55508384 TCATTTTAAAATAGTAAATCAGG - Intronic
974422307 4:61692797-61692819 AAATTGTAATAGAGTGAATTGGG - Intronic
975127059 4:70794614-70794636 TAAGCTTAACTGTGTGAATCTGG - Intronic
975981768 4:80169322-80169344 TAATAATAACAGAGTGATACTGG - Intergenic
976668398 4:87625056-87625078 TAAGTTTAACAGAGTTTAACTGG - Intergenic
977104202 4:92859607-92859629 GAATTTTTACAAGGTGAATCTGG - Intronic
977739203 4:100457130-100457152 TAAATTTAAAAGAGTGAAAAAGG - Intronic
978011119 4:103686089-103686111 TAAATTTAACAGGATGATTCAGG + Intronic
978505838 4:109454941-109454963 TAATGTGAACAGACTGAATGGGG - Intronic
978876588 4:113646843-113646865 TAATTTTAACAGGATTACTCTGG - Intronic
979127225 4:116989791-116989813 AATTTTTAACAGAGTGAAAAGGG - Intergenic
979535219 4:121812035-121812057 TAATTTTAGCAGTGTTAATAAGG - Intronic
980024041 4:127743854-127743876 TATTTTTAAAAGACTGATTCTGG + Intronic
980180785 4:129398140-129398162 TAATTTTAAGAGAATGCAGCAGG + Intergenic
980287006 4:130792490-130792512 TAATTTTAAAAGTGTGAAAAAGG - Intergenic
980543222 4:134222429-134222451 CAATTTCAACAGAGTGAATTGGG - Intergenic
981592591 4:146381004-146381026 TAATTATAAATGAGTGGATCAGG - Intronic
981996661 4:150982778-150982800 TCAGTTTAACCAAGTGAATCAGG + Intronic
982196183 4:152917409-152917431 TAATTTTAGAAGTGTGAATTAGG - Intronic
982867317 4:160531067-160531089 TCCTTTTAACTGATTGAATCAGG + Intergenic
983909219 4:173218025-173218047 AAAATTTAACAAAGTGATTCAGG - Intronic
987579550 5:19772291-19772313 TAATTTAAGGAGAGTTAATCTGG + Intronic
989203532 5:38789188-38789210 TAAATTTAACAAGGAGAATCTGG + Intergenic
991390190 5:66134514-66134536 TCATTTTCACAGGGTGAATTTGG - Intergenic
991534991 5:67659780-67659802 TCATTTTAAAAGACTGAATGTGG - Intergenic
992073491 5:73170288-73170310 TTATTTTAATAGAGAGAATTTGG + Intergenic
992151386 5:73907643-73907665 TAAAGTTAAGAGAGTGAATTGGG + Intronic
992576054 5:78113911-78113933 TGTTTTTCAGAGAGTGAATCTGG - Exonic
993026129 5:82648804-82648826 GAAATTTAACAGAGTGAAATGGG - Intergenic
993958381 5:94265377-94265399 AAATTTTAACACAGTGAAAAAGG - Intronic
994977629 5:106830265-106830287 AATTTTTAACAGGGTAAATCAGG - Intergenic
998010818 5:138694332-138694354 TAATGTTAACAGACTGAGTGGGG + Intronic
998798118 5:145840291-145840313 TAATACTAACAGACTGAGTCAGG - Intergenic
999610019 5:153359300-153359322 TTATTTTAACAGAGTGAGGGGGG - Intergenic
1000266612 5:159644049-159644071 TAATAATAACAGATTAAATCTGG + Intergenic
1000756171 5:165162784-165162806 TAATATGCAAAGAGTGAATCTGG + Intergenic
1000857160 5:166412894-166412916 TCATTTTAACAGAGTCACTTAGG + Intergenic
1001137287 5:169113019-169113041 TAATTTTAAAAGAGGGTTTCAGG - Intronic
1001867524 5:175118131-175118153 TAATCCTAACAGAGGGCATCAGG - Intergenic
1003201868 6:3968843-3968865 TAAATTTAACAGAGTTTAACTGG - Intergenic
1003343060 6:5240210-5240232 AGATTTTACCAGAGTGAGTCAGG - Intronic
1003424560 6:5989430-5989452 TAATTTTCCCATAGTGAATGTGG + Intergenic
1004033227 6:11894188-11894210 GAAGTTTAACAGAGAGAACCAGG - Intergenic
1005383898 6:25266599-25266621 TCATTTTAACTGAGTCATTCCGG - Intergenic
1005853888 6:29845655-29845677 TAATTTAAAGAGAGTGAAACAGG - Intergenic
1006973955 6:38079057-38079079 TGATTTTAACAGAGTTGATTTGG + Intronic
1007874523 6:45080969-45080991 TAATTTTATCAGGGTAAATGAGG - Intronic
1007952020 6:45880955-45880977 TAATTTTACTAGAGGGAATGGGG + Intergenic
1009387387 6:63101961-63101983 TAATTTTAACATTGTGTCTCAGG + Intergenic
1009637973 6:66290927-66290949 TAATTTGAACAGATTGGATTGGG + Intergenic
1009781043 6:68271138-68271160 TTATTTTAACAGACTGATTGAGG + Intergenic
1009836205 6:69004698-69004720 TAAGTTAGAAAGAGTGAATCAGG - Intronic
1010057211 6:71580424-71580446 TAATTTATACACAGTGAATCAGG + Intergenic
1010427644 6:75744787-75744809 TAATTTTAGCAGTGTTAATAAGG + Intergenic
1010725677 6:79329548-79329570 TAATTTTAGCAGAGTAAAACAGG + Intergenic
1011428764 6:87261213-87261235 TAATTTGAAGAGAGTTAATAAGG + Exonic
1011759583 6:90547377-90547399 TAATTTTAACAGAGTGAATCTGG - Exonic
1011914104 6:92480864-92480886 AAATTCTAGCAGATTGAATCTGG - Intergenic
1013846791 6:114462735-114462757 CAACTGTAACAGAGTCAATCTGG - Intergenic
1014054459 6:116997564-116997586 TTCTTTTAGCATAGTGAATCGGG - Intergenic
1014303036 6:119707405-119707427 AAATTTTAGGAGAGGGAATCTGG - Intergenic
1015617956 6:135099047-135099069 TAATTAAAACACTGTGAATCTGG - Intronic
1015643112 6:135358701-135358723 TCATTTTAAAGGAGGGAATCAGG - Intronic
1016068174 6:139705506-139705528 TCATTTAAACAGGGTGAAACAGG - Intergenic
1016169461 6:140992348-140992370 CAATATTAACAAATTGAATCTGG + Intergenic
1016345423 6:143108243-143108265 TATTTTTAGTAGAGTAAATCTGG - Intronic
1016594333 6:145782423-145782445 TAATTTTAAAAGAGTGAAGGAGG + Intergenic
1016603178 6:145887442-145887464 TAATTTTAAAAGCTTGACTCTGG - Intronic
1016854928 6:148657935-148657957 AAAGTTTAACAGAGAGAATCAGG + Intergenic
1017704407 6:157108167-157108189 TATCTTTAACAGAATGAATTTGG + Intronic
1018933185 6:168255588-168255610 TAATATAAACAGAGAGAATTGGG - Intergenic
1019092537 6:169551451-169551473 TTGTTTTAACAGAGTCACTCAGG - Intronic
1020605602 7:10333104-10333126 TATTTTTTAAAGAGTAAATCTGG + Intergenic
1024496083 7:50047343-50047365 TAATTTTATCAGAAAGGATCTGG - Intronic
1027671597 7:81106072-81106094 TAATATTTACAGAGTGTATCCGG - Intergenic
1027809889 7:82882113-82882135 TAATTTTAAAGAATTGAATCTGG + Intronic
1027848218 7:83412906-83412928 TAATTTTAATAGATTAAAACAGG + Intronic
1027932993 7:84563826-84563848 TAAATTAAACAGATTGAATTAGG - Intergenic
1031979206 7:128113635-128113657 TTTTTTTAAAAGAATGAATCTGG + Intergenic
1032873083 7:136007385-136007407 TAATTTTGACCCAGTGAATATGG + Intergenic
1033285078 7:140034449-140034471 TATTTTTAACAGACTGATTCTGG - Intronic
1033353024 7:140577744-140577766 TAGTTTTAACAGAGAGGATATGG - Intronic
1034536430 7:151728541-151728563 TATTTTTAAAATAGTGACTCTGG - Intronic
1034605844 7:152313972-152313994 CAAATTTAATGGAGTGAATCAGG - Intronic
1035059599 7:156059257-156059279 TAATTTTAACTGATTTAATAAGG - Intergenic
1036950975 8:13138986-13139008 TATTTTTAAGAGAGAGAAGCTGG + Intronic
1037673251 8:21033693-21033715 TAATATTAACAGACTGAGTGGGG + Intergenic
1037701231 8:21275443-21275465 TAATTTTAAAAGAGAAAATTAGG - Intergenic
1038186169 8:25276976-25276998 TAATTTTAGCAGTGTTAATAAGG - Intronic
1040505311 8:48042077-48042099 TAAATTTAAAAGAGTGGATACGG - Intronic
1040611494 8:48987944-48987966 TAATTTTAAAAGTGAGAAACAGG - Intergenic
1040778066 8:51071245-51071267 GAATTTTAACAGAGATAATCAGG + Intergenic
1041914823 8:63128182-63128204 TAATTTTAAGTGTGTGAATGTGG + Intergenic
1042047870 8:64674123-64674145 TAATTTTAACAAAGTTAATTAGG - Intronic
1042172421 8:66005068-66005090 TCCTTTTAACTGATTGAATCAGG - Intergenic
1043554708 8:81417638-81417660 TAATTATATCAGAGTAAATGGGG - Intergenic
1044250146 8:89996859-89996881 TATTTTTAATAGAGAGAATAAGG - Intronic
1044979918 8:97706601-97706623 AAAATTTAACAGTGTGAATTAGG - Intronic
1045913103 8:107433624-107433646 TAATTTTAAAAGGATGAAACAGG + Intronic
1045920053 8:107518785-107518807 TCATTTAAAAAGAGTGACTCAGG + Intergenic
1045936482 8:107685387-107685409 TAAATTTAACAGAGTTTATTTGG - Intergenic
1046595753 8:116259419-116259441 TAACTCTAACAGAGTGACTAGGG + Intergenic
1047150225 8:122252503-122252525 TAATATTAACAGATTTGATCTGG + Intergenic
1047158440 8:122349099-122349121 TAATTTTAACATGATGTATCAGG - Intergenic
1048384011 8:133894294-133894316 GAACTTTAACACAATGAATCTGG - Intergenic
1048753065 8:137701559-137701581 TAGTTTAACCACAGTGAATCTGG - Intergenic
1051104289 9:13560831-13560853 TAATTTGAACAAAATGCATCTGG + Intergenic
1053297670 9:36926546-36926568 TAATTTTCTGAGAATGAATCGGG + Intronic
1053649821 9:40155805-40155827 TAATTCTAACAGAGAAAAACTGG + Intergenic
1053755928 9:41308137-41308159 TAATTCTAACAGAGAAAAACTGG - Intergenic
1054330330 9:63747567-63747589 TAATTCTAACAGAGAAAAACTGG + Intergenic
1054534760 9:66220398-66220420 TAATTCTAACAGAGAAAAACTGG - Intergenic
1055247590 9:74265461-74265483 GAATTTTAACAGACTGATTAAGG + Intergenic
1055739545 9:79371481-79371503 TGATCTTATCAGAGTGAATCAGG - Intergenic
1056689726 9:88797665-88797687 CAATCTTAACAGAGAGAATATGG - Intergenic
1056941143 9:90957738-90957760 TAATTTAAGCAAAGTGAAACAGG + Intergenic
1057129915 9:92647723-92647745 TATATTTAAAAGAGTGAATCTGG + Intronic
1202797709 9_KI270719v1_random:140456-140478 TAATTCTAACAGAGAAAAACTGG + Intergenic
1185955918 X:4488862-4488884 TAATTTGAACAAAATGAATATGG - Intergenic
1186983506 X:14985019-14985041 TAATTATATCAGAGTAAATGGGG - Intergenic
1187001539 X:15184891-15184913 TAAATTTACCAGAATGAAGCTGG - Intergenic
1187380111 X:18794225-18794247 GAAATTTAACAGACTGAATCGGG - Intronic
1188166019 X:26865357-26865379 AGTTTTTGACAGAGTGAATCTGG + Intergenic
1188565784 X:31524540-31524562 GAATCTTATCAGAGTGAAACCGG - Intronic
1189981751 X:46517905-46517927 TAATCATATCAGAGTGAATGGGG - Intronic
1190688031 X:52891478-52891500 AAATTATAACAGAGTGACTAGGG + Intronic
1190697951 X:52964314-52964336 AAATTATAACAGAGTGACTAGGG - Intronic
1191062717 X:56316895-56316917 TAATTTTTAAAGAGTAAAGCAGG - Intergenic
1192223550 X:69213462-69213484 TAATTGGAACAGAGTGAGTAAGG + Intergenic
1192613646 X:72593864-72593886 GAAGTTTAACAGAGATAATCAGG - Intronic
1192728494 X:73778130-73778152 TAATTTTATCTGAGTGAACCTGG + Intergenic
1193224252 X:78963211-78963233 TCATTTGAACAGAGTGACTATGG + Intergenic
1194041045 X:88942360-88942382 TAATCTTAACAGACTGAAAGGGG + Intergenic
1194761884 X:97804498-97804520 TAATTTTAACAAAGGAAATGGGG - Intergenic
1194769313 X:97881576-97881598 TAATTGTAGAAGTGTGAATCTGG - Intergenic
1194983544 X:100465616-100465638 TAATTAAAACAGTGTGAATATGG - Intergenic
1195600577 X:106742657-106742679 AAATATTAACACAGTGAATAAGG - Intronic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1196438214 X:115693840-115693862 TCCTTTTAGCAGAGTGAATTGGG + Intergenic
1196650418 X:118163160-118163182 TAATTTTAATATAGAGAACCTGG + Intergenic
1197659033 X:129149854-129149876 TAATTTTACCAGAGTGTTTCAGG - Intergenic
1198104765 X:133451537-133451559 TAAATTTAACAGAGTTAGGCTGG - Intergenic
1201226391 Y:11822959-11822981 TAATGCTAACAGAGTGAGTGGGG - Intergenic