ID: 1011765002

View in Genome Browser
Species Human (GRCh38)
Location 6:90611032-90611054
Sequence GGGCTCCGGCCAGACCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011764995_1011765002 -3 Left 1011764995 6:90611012-90611034 CCGCTCCTCACCCCAGATCGGGG No data
Right 1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG No data
1011764989_1011765002 27 Left 1011764989 6:90610982-90611004 CCGAGCTAAGTGCCAGAGCCAGG No data
Right 1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG No data
1011764991_1011765002 15 Left 1011764991 6:90610994-90611016 CCAGAGCCAGGATTCTCACCGCT No data
Right 1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG No data
1011764992_1011765002 9 Left 1011764992 6:90611000-90611022 CCAGGATTCTCACCGCTCCTCAC No data
Right 1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG No data
1011764997_1011765002 -8 Left 1011764997 6:90611017-90611039 CCTCACCCCAGATCGGGGCTCCG No data
Right 1011765002 6:90611032-90611054 GGGCTCCGGCCAGACCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011765002 Original CRISPR GGGCTCCGGCCAGACCACGC TGG Intergenic
No off target data available for this crispr