ID: 1011767085

View in Genome Browser
Species Human (GRCh38)
Location 6:90633815-90633837
Sequence CACCTTTTGAATCTGTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011767081_1011767085 22 Left 1011767081 6:90633770-90633792 CCTGGGCATAGAAGAAGGCTGAG No data
Right 1011767085 6:90633815-90633837 CACCTTTTGAATCTGTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011767085 Original CRISPR CACCTTTTGAATCTGTACAT GGG Intergenic
No off target data available for this crispr