ID: 1011779075

View in Genome Browser
Species Human (GRCh38)
Location 6:90766449-90766471
Sequence CTCTGCAATTCCAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011779075_1011779077 -9 Left 1011779075 6:90766449-90766471 CCATTCACCTTGGAATTGCAGAG No data
Right 1011779077 6:90766463-90766485 ATTGCAGAGAAACCAAACTGAGG No data
1011779075_1011779081 29 Left 1011779075 6:90766449-90766471 CCATTCACCTTGGAATTGCAGAG No data
Right 1011779081 6:90766501-90766523 TTGCCCAACAGGAATGTCCATGG No data
1011779075_1011779078 -8 Left 1011779075 6:90766449-90766471 CCATTCACCTTGGAATTGCAGAG No data
Right 1011779078 6:90766464-90766486 TTGCAGAGAAACCAAACTGAGGG No data
1011779075_1011779080 18 Left 1011779075 6:90766449-90766471 CCATTCACCTTGGAATTGCAGAG No data
Right 1011779080 6:90766490-90766512 ACATACAAAGCTTGCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011779075 Original CRISPR CTCTGCAATTCCAAGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr