ID: 1011781437

View in Genome Browser
Species Human (GRCh38)
Location 6:90794330-90794352
Sequence TGCCAAGTGCTGACCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011781434_1011781437 1 Left 1011781434 6:90794306-90794328 CCTAATTATGTATGGCTATTTCC No data
Right 1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011781437 Original CRISPR TGCCAAGTGCTGACCAGGCC TGG Intergenic
No off target data available for this crispr