ID: 1011790106

View in Genome Browser
Species Human (GRCh38)
Location 6:90889754-90889776
Sequence CTTCTTATCACACGTGTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011790102_1011790106 6 Left 1011790102 6:90889725-90889747 CCACATGCATCTAATAGCGAGTC No data
Right 1011790106 6:90889754-90889776 CTTCTTATCACACGTGTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011790106 Original CRISPR CTTCTTATCACACGTGTCTC GGG Intergenic
No off target data available for this crispr