ID: 1011792463

View in Genome Browser
Species Human (GRCh38)
Location 6:90913425-90913447
Sequence CAGGGGGATGGTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011792463_1011792475 12 Left 1011792463 6:90913425-90913447 CCCTCCTCCTCACCATCCCCCTG No data
Right 1011792475 6:90913460-90913482 AGGATTAATGAACTAGTGTTGGG No data
1011792463_1011792469 -8 Left 1011792463 6:90913425-90913447 CCCTCCTCCTCACCATCCCCCTG No data
Right 1011792469 6:90913440-90913462 TCCCCCTGATGAGGTGTTCAAGG No data
1011792463_1011792474 11 Left 1011792463 6:90913425-90913447 CCCTCCTCCTCACCATCCCCCTG No data
Right 1011792474 6:90913459-90913481 AAGGATTAATGAACTAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011792463 Original CRISPR CAGGGGGATGGTGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr