ID: 1011793784

View in Genome Browser
Species Human (GRCh38)
Location 6:90930071-90930093
Sequence GTGTAAACTAACATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011793782_1011793784 0 Left 1011793782 6:90930048-90930070 CCAGGGCAACTGATGCCAGGGGT No data
Right 1011793784 6:90930071-90930093 GTGTAAACTAACATGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011793784 Original CRISPR GTGTAAACTAACATGAAGCT AGG Intergenic
No off target data available for this crispr