ID: 1011798406

View in Genome Browser
Species Human (GRCh38)
Location 6:90982775-90982797
Sequence GAGAGAACTGCTCTCGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011798406_1011798413 19 Left 1011798406 6:90982775-90982797 CCACCCGCGAGAGCAGTTCTCTC No data
Right 1011798413 6:90982817-90982839 CTGACCCACAGTCTCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011798406 Original CRISPR GAGAGAACTGCTCTCGCGGG TGG (reversed) Intergenic