ID: 1011798616

View in Genome Browser
Species Human (GRCh38)
Location 6:90983848-90983870
Sequence TTGTGCCAGTTAAAGATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011798616_1011798618 22 Left 1011798616 6:90983848-90983870 CCAGTGATCTTTAACTGGCACAA No data
Right 1011798618 6:90983893-90983915 CAGCTAGTATGGAGATTTATAGG No data
1011798616_1011798617 11 Left 1011798616 6:90983848-90983870 CCAGTGATCTTTAACTGGCACAA No data
Right 1011798617 6:90983882-90983904 ACTTTTGTCATCAGCTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011798616 Original CRISPR TTGTGCCAGTTAAAGATCAC TGG (reversed) Intergenic
No off target data available for this crispr