ID: 1011802754

View in Genome Browser
Species Human (GRCh38)
Location 6:91036418-91036440
Sequence CCCCACCTTCTCCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011802754_1011802759 -9 Left 1011802754 6:91036418-91036440 CCCATCCTTGGGAGAAGGTGGGG No data
Right 1011802759 6:91036432-91036454 AAGGTGGGGTGAAGTGGCACAGG No data
1011802754_1011802760 -8 Left 1011802754 6:91036418-91036440 CCCATCCTTGGGAGAAGGTGGGG No data
Right 1011802760 6:91036433-91036455 AGGTGGGGTGAAGTGGCACAGGG No data
1011802754_1011802761 -7 Left 1011802754 6:91036418-91036440 CCCATCCTTGGGAGAAGGTGGGG No data
Right 1011802761 6:91036434-91036456 GGTGGGGTGAAGTGGCACAGGGG No data
1011802754_1011802763 11 Left 1011802754 6:91036418-91036440 CCCATCCTTGGGAGAAGGTGGGG No data
Right 1011802763 6:91036452-91036474 AGGGGATCAAGTAGTGGTTGAGG No data
1011802754_1011802762 5 Left 1011802754 6:91036418-91036440 CCCATCCTTGGGAGAAGGTGGGG No data
Right 1011802762 6:91036446-91036468 TGGCACAGGGGATCAAGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011802754 Original CRISPR CCCCACCTTCTCCCAAGGAT GGG (reversed) Intergenic
No off target data available for this crispr