ID: 1011806647

View in Genome Browser
Species Human (GRCh38)
Location 6:91079901-91079923
Sequence CTACACAACTTTGCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011806647_1011806651 23 Left 1011806647 6:91079901-91079923 CCTGTTTTTGCAAAGTTGTGTAG No data
Right 1011806651 6:91079947-91079969 GGAGCAAGCAGCCTGTGCAGTGG No data
1011806647_1011806648 2 Left 1011806647 6:91079901-91079923 CCTGTTTTTGCAAAGTTGTGTAG No data
Right 1011806648 6:91079926-91079948 GAAGCAGCCTTTACCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011806647 Original CRISPR CTACACAACTTTGCAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr