ID: 1011806804

View in Genome Browser
Species Human (GRCh38)
Location 6:91081192-91081214
Sequence AAGAAGTACAAGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011806804_1011806810 7 Left 1011806804 6:91081192-91081214 CCACCTGCCCTCTTGTACTTCTT No data
Right 1011806810 6:91081222-91081244 AAGGGTGTGTAGAGAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011806804 Original CRISPR AAGAAGTACAAGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr