ID: 1011812040

View in Genome Browser
Species Human (GRCh38)
Location 6:91144037-91144059
Sequence AGTTATCAGCAGAAAACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011812036_1011812040 16 Left 1011812036 6:91143998-91144020 CCTGGAGGACATAGGTATAGTTT No data
Right 1011812040 6:91144037-91144059 AGTTATCAGCAGAAAACAGCTGG No data
1011812037_1011812040 -10 Left 1011812037 6:91144024-91144046 CCCACTGCTCCTAAGTTATCAGC No data
Right 1011812040 6:91144037-91144059 AGTTATCAGCAGAAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011812040 Original CRISPR AGTTATCAGCAGAAAACAGC TGG Intergenic
No off target data available for this crispr