ID: 1011816945

View in Genome Browser
Species Human (GRCh38)
Location 6:91203085-91203107
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011816945_1011816954 21 Left 1011816945 6:91203085-91203107 CCATTATTCCTCCCCCTTCACAA No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011816945 Original CRISPR TTGTGAAGGGGGAGGAATAA TGG (reversed) Intergenic
No off target data available for this crispr