ID: 1011816954

View in Genome Browser
Species Human (GRCh38)
Location 6:91203129-91203151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011816949_1011816954 9 Left 1011816949 6:91203097-91203119 CCCCTTCACAAATGGTAGCCACC No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816948_1011816954 10 Left 1011816948 6:91203096-91203118 CCCCCTTCACAAATGGTAGCCAC No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816952_1011816954 -9 Left 1011816952 6:91203115-91203137 CCACCATAATACTTTCTACGAAT No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816945_1011816954 21 Left 1011816945 6:91203085-91203107 CCATTATTCCTCCCCCTTCACAA No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816950_1011816954 8 Left 1011816950 6:91203098-91203120 CCCTTCACAAATGGTAGCCACCA No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816947_1011816954 13 Left 1011816947 6:91203093-91203115 CCTCCCCCTTCACAAATGGTAGC No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data
1011816951_1011816954 7 Left 1011816951 6:91203099-91203121 CCTTCACAAATGGTAGCCACCAT No data
Right 1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011816954 Original CRISPR TCTACGAATGTGACCACTCT AGG Intergenic