ID: 1011817776

View in Genome Browser
Species Human (GRCh38)
Location 6:91213206-91213228
Sequence CCTGCTCTGCTGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011817769_1011817776 24 Left 1011817769 6:91213159-91213181 CCTGTGATGTAAATTGTCTTCAG No data
Right 1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011817776 Original CRISPR CCTGCTCTGCTGAAGGTGGC AGG Intergenic
No off target data available for this crispr