ID: 1011819454

View in Genome Browser
Species Human (GRCh38)
Location 6:91234356-91234378
Sequence TAAAATGCAGATGATGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011819454_1011819455 1 Left 1011819454 6:91234356-91234378 CCAATATCATCATCTGCATTTTA No data
Right 1011819455 6:91234380-91234402 ATATGAAGAAATTGCAGCTCAGG No data
1011819454_1011819456 24 Left 1011819454 6:91234356-91234378 CCAATATCATCATCTGCATTTTA No data
Right 1011819456 6:91234403-91234425 AGAATCACACGCCATGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011819454 Original CRISPR TAAAATGCAGATGATGATAT TGG (reversed) Intergenic
No off target data available for this crispr