ID: 1011820201

View in Genome Browser
Species Human (GRCh38)
Location 6:91244577-91244599
Sequence CCCTCTGGGAACCCCCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011820201_1011820205 15 Left 1011820201 6:91244577-91244599 CCAGACTGGGGGTTCCCAGAGGG No data
Right 1011820205 6:91244615-91244637 GTGTCCTCATTTTCCCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011820201 Original CRISPR CCCTCTGGGAACCCCCAGTC TGG (reversed) Intergenic
No off target data available for this crispr