ID: 1011823090

View in Genome Browser
Species Human (GRCh38)
Location 6:91275279-91275301
Sequence CTGGATTATGGTTCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011823076_1011823090 21 Left 1011823076 6:91275235-91275257 CCACTGGAAGGATTCAAGCAGGG No data
Right 1011823090 6:91275279-91275301 CTGGATTATGGTTCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011823090 Original CRISPR CTGGATTATGGTTCCTCTCC AGG Intergenic
No off target data available for this crispr