ID: 1011823217

View in Genome Browser
Species Human (GRCh38)
Location 6:91276516-91276538
Sequence CTTTGCCACTAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011823213_1011823217 5 Left 1011823213 6:91276488-91276510 CCTAGACATTAGAGGTGAGATGG No data
Right 1011823217 6:91276516-91276538 CTTTGCCACTAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011823217 Original CRISPR CTTTGCCACTAGAGGGAAGA AGG Intergenic
No off target data available for this crispr