ID: 1011827579

View in Genome Browser
Species Human (GRCh38)
Location 6:91328443-91328465
Sequence AATGGGCCCCGGCAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011827572_1011827579 1 Left 1011827572 6:91328419-91328441 CCATGTATTATGACAAAAGATGC No data
Right 1011827579 6:91328443-91328465 AATGGGCCCCGGCAGTGGGTGGG No data
1011827571_1011827579 8 Left 1011827571 6:91328412-91328434 CCATTTGCCATGTATTATGACAA No data
Right 1011827579 6:91328443-91328465 AATGGGCCCCGGCAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011827579 Original CRISPR AATGGGCCCCGGCAGTGGGT GGG Intergenic
No off target data available for this crispr