ID: 1011829433

View in Genome Browser
Species Human (GRCh38)
Location 6:91353425-91353447
Sequence GGGTATTATTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011829433_1011829440 -3 Left 1011829433 6:91353425-91353447 CCCTCTTCCCTCCAATAATACCC No data
Right 1011829440 6:91353445-91353467 CCCTGACAAGGTGTTGTTATAGG No data
1011829433_1011829442 21 Left 1011829433 6:91353425-91353447 CCCTCTTCCCTCCAATAATACCC No data
Right 1011829442 6:91353469-91353491 CAAATCATGCACCCATCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011829433 Original CRISPR GGGTATTATTGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr