ID: 1011837343

View in Genome Browser
Species Human (GRCh38)
Location 6:91449913-91449935
Sequence ACGCCCAGATACCACACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011837343_1011837344 -1 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837344 6:91449935-91449957 TGCTGAATACTTTGCACAGAAGG No data
1011837343_1011837346 7 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837346 6:91449943-91449965 ACTTTGCACAGAAGGAACTCGGG No data
1011837343_1011837347 10 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837347 6:91449946-91449968 TTGCACAGAAGGAACTCGGGAGG No data
1011837343_1011837348 11 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837348 6:91449947-91449969 TGCACAGAAGGAACTCGGGAGGG No data
1011837343_1011837345 6 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG No data
1011837343_1011837349 25 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837349 6:91449961-91449983 TCGGGAGGGCCTCAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011837343 Original CRISPR ACGCCCAGATACCACACTTC AGG (reversed) Intergenic
No off target data available for this crispr