ID: 1011837345

View in Genome Browser
Species Human (GRCh38)
Location 6:91449942-91449964
Sequence TACTTTGCACAGAAGGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011837343_1011837345 6 Left 1011837343 6:91449913-91449935 CCTGAAGTGTGGTATCTGGGCGT No data
Right 1011837345 6:91449942-91449964 TACTTTGCACAGAAGGAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011837345 Original CRISPR TACTTTGCACAGAAGGAACT CGG Intergenic
No off target data available for this crispr