ID: 1011844645

View in Genome Browser
Species Human (GRCh38)
Location 6:91548373-91548395
Sequence TCTCCATTTGACCACGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011844645_1011844646 -4 Left 1011844645 6:91548373-91548395 CCATTCACGTGGTCAAATGGAGA No data
Right 1011844646 6:91548392-91548414 GAGACAGTGATTCAAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011844645 Original CRISPR TCTCCATTTGACCACGTGAA TGG (reversed) Intergenic