ID: 1011844646 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:91548392-91548414 |
| Sequence | GAGACAGTGATTCAAGTAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011844645_1011844646 | -4 | Left | 1011844645 | 6:91548373-91548395 | CCATTCACGTGGTCAAATGGAGA | 0: 1 1: 0 2: 0 3: 7 4: 69 |
||
| Right | 1011844646 | 6:91548392-91548414 | GAGACAGTGATTCAAGTAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011844646 | Original CRISPR | GAGACAGTGATTCAAGTAAC AGG | Intergenic | ||