ID: 1011847330

View in Genome Browser
Species Human (GRCh38)
Location 6:91582338-91582360
Sequence GAGGATTGGAAGGATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011847330_1011847335 4 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847335 6:91582365-91582387 CTCAATGATTCTTTCCTTGGAGG No data
1011847330_1011847336 9 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847336 6:91582370-91582392 TGATTCTTTCCTTGGAGGAAAGG No data
1011847330_1011847340 30 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847340 6:91582391-91582413 GGGCACTACCTGGTCTTATTCGG No data
1011847330_1011847334 1 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847334 6:91582362-91582384 AAACTCAATGATTCTTTCCTTGG No data
1011847330_1011847337 10 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847337 6:91582371-91582393 GATTCTTTCCTTGGAGGAAAGGG No data
1011847330_1011847339 20 Left 1011847330 6:91582338-91582360 CCTTCTGCATCCTTCCAATCCTC No data
Right 1011847339 6:91582381-91582403 TTGGAGGAAAGGGCACTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011847330 Original CRISPR GAGGATTGGAAGGATGCAGA AGG (reversed) Intergenic
No off target data available for this crispr