ID: 1011851816

View in Genome Browser
Species Human (GRCh38)
Location 6:91638717-91638739
Sequence GATCAGAGCCTATTTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011851816_1011851819 5 Left 1011851816 6:91638717-91638739 CCTGGCTAAAATAGGCTCTGATC No data
Right 1011851819 6:91638745-91638767 TCCTCCTAACCCTAGGAACATGG No data
1011851816_1011851817 -2 Left 1011851816 6:91638717-91638739 CCTGGCTAAAATAGGCTCTGATC No data
Right 1011851817 6:91638738-91638760 TCCTATTTCCTCCTAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011851816 Original CRISPR GATCAGAGCCTATTTTAGCC AGG (reversed) Intergenic
No off target data available for this crispr