ID: 1011852575

View in Genome Browser
Species Human (GRCh38)
Location 6:91648574-91648596
Sequence AAAAGATATCTGGTCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011852575_1011852578 1 Left 1011852575 6:91648574-91648596 CCAAAATTGACCAGATATCTTTT No data
Right 1011852578 6:91648598-91648620 AAAACATAAATAATTTGGAGAGG No data
1011852575_1011852579 7 Left 1011852575 6:91648574-91648596 CCAAAATTGACCAGATATCTTTT No data
Right 1011852579 6:91648604-91648626 TAAATAATTTGGAGAGGCAGTGG No data
1011852575_1011852577 -4 Left 1011852575 6:91648574-91648596 CCAAAATTGACCAGATATCTTTT No data
Right 1011852577 6:91648593-91648615 TTTTGAAAACATAAATAATTTGG No data
1011852575_1011852581 11 Left 1011852575 6:91648574-91648596 CCAAAATTGACCAGATATCTTTT No data
Right 1011852581 6:91648608-91648630 TAATTTGGAGAGGCAGTGGTGGG No data
1011852575_1011852580 10 Left 1011852575 6:91648574-91648596 CCAAAATTGACCAGATATCTTTT No data
Right 1011852580 6:91648607-91648629 ATAATTTGGAGAGGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011852575 Original CRISPR AAAAGATATCTGGTCAATTT TGG (reversed) Intergenic
No off target data available for this crispr