ID: 1011855674

View in Genome Browser
Species Human (GRCh38)
Location 6:91687546-91687568
Sequence TCATTATTGTACACAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011855674_1011855678 -7 Left 1011855674 6:91687546-91687568 CCTCCATCTGTGTACAATAATGA No data
Right 1011855678 6:91687562-91687584 ATAATGAGGAAGACTGGCAGAGG No data
1011855674_1011855679 -2 Left 1011855674 6:91687546-91687568 CCTCCATCTGTGTACAATAATGA No data
Right 1011855679 6:91687567-91687589 GAGGAAGACTGGCAGAGGCCTGG No data
1011855674_1011855681 17 Left 1011855674 6:91687546-91687568 CCTCCATCTGTGTACAATAATGA No data
Right 1011855681 6:91687586-91687608 CTGGATTATATTGCTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011855674 Original CRISPR TCATTATTGTACACAGATGG AGG (reversed) Intergenic
No off target data available for this crispr