ID: 1011857737

View in Genome Browser
Species Human (GRCh38)
Location 6:91715846-91715868
Sequence TCTGTAAAGCAGATATTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011857737_1011857738 4 Left 1011857737 6:91715846-91715868 CCGTACAATATCTGCTTTACAGA No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011857737 Original CRISPR TCTGTAAAGCAGATATTGTA CGG (reversed) Intergenic
No off target data available for this crispr