ID: 1011857738

View in Genome Browser
Species Human (GRCh38)
Location 6:91715873-91715895
Sequence ACATCTATCACTAGTAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011857732_1011857738 26 Left 1011857732 6:91715824-91715846 CCTGTTGGGCATACTCTTCCCCC No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data
1011857735_1011857738 6 Left 1011857735 6:91715844-91715866 CCCCGTACAATATCTGCTTTACA No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data
1011857736_1011857738 5 Left 1011857736 6:91715845-91715867 CCCGTACAATATCTGCTTTACAG No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data
1011857737_1011857738 4 Left 1011857737 6:91715846-91715868 CCGTACAATATCTGCTTTACAGA No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data
1011857733_1011857738 8 Left 1011857733 6:91715842-91715864 CCCCCCGTACAATATCTGCTTTA No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data
1011857734_1011857738 7 Left 1011857734 6:91715843-91715865 CCCCCGTACAATATCTGCTTTAC No data
Right 1011857738 6:91715873-91715895 ACATCTATCACTAGTAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011857738 Original CRISPR ACATCTATCACTAGTAACAG TGG Intergenic
No off target data available for this crispr