ID: 1011858631

View in Genome Browser
Species Human (GRCh38)
Location 6:91726841-91726863
Sequence AGGTAGGCCTAGAATTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 9, 3: 11, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011858631_1011858638 14 Left 1011858631 6:91726841-91726863 CCCCCACAATTCTAGGCCTACCT 0: 1
1: 0
2: 9
3: 11
4: 104
Right 1011858638 6:91726878-91726900 CATCCTATTTCCCCCCTTACTGG 0: 2
1: 0
2: 0
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011858631 Original CRISPR AGGTAGGCCTAGAATTGTGG GGG (reversed) Intergenic
900056329 1:633727-633749 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
904468941 1:30723901-30723923 AGGTATGCCTAGGCTTGGGGTGG - Intergenic
905633315 1:39531107-39531129 AGGTAGGCCTGGGGTTGGGGAGG + Intergenic
906994820 1:50780912-50780934 AGACAGGGCCAGAATTGTGGTGG + Intronic
907243705 1:53094283-53094305 AGGAAGGCCTAGAATGCCGGGGG - Intronic
907506897 1:54925720-54925742 AGGTAGGCATAAAAATGTGATGG - Intergenic
911172329 1:94782889-94782911 AGCTACCCTTAGAATTGTGGTGG + Intergenic
912146735 1:106803374-106803396 AGGTAGAACTAGAATTGTTGGGG + Intergenic
916091873 1:161314005-161314027 AGGTCGGCCTAAAAACGTGGTGG - Intergenic
916718564 1:167465213-167465235 AGGTTGGCCTAGCAGGGTGGTGG - Intronic
918312227 1:183293014-183293036 AGGCAGGCCTGGAATGGTGGTGG + Intronic
919660250 1:200237092-200237114 AGGCAGGGCTTGAATTGTGAAGG - Intergenic
920030408 1:203034347-203034369 AGGTAGGGCTGGATTTCTGGAGG + Intronic
921152489 1:212413507-212413529 AGGTAGCCCTTGACTTCTGGGGG + Intronic
1069584663 10:69590302-69590324 GGGTAGGCCTAGTATTGTTGGGG + Intergenic
1072975913 10:100057616-100057638 GGGTAGGCCTAGTACTGTAGGGG + Intronic
1074629935 10:115241457-115241479 AGGTTTCCCTGGAATTGTGGGGG - Intronic
1075334331 10:121597838-121597860 CGGAAGGACTAGCATTGTGGAGG - Intronic
1076135471 10:128042591-128042613 CGTTTGACCTAGAATTGTGGAGG + Intronic
1077634730 11:3834688-3834710 AGGCAGGCCCAGAATGGGGGAGG + Intronic
1078762303 11:14261052-14261074 AGGCAAGCCTATAATTGTTGGGG - Intronic
1080349665 11:31369351-31369373 AGGTAGGGCTAGATGTGCGGGGG - Intronic
1084869574 11:72088926-72088948 AGGCAGGCCTAGAGTAGTAGAGG + Intronic
1087879850 11:103403208-103403230 GGGTAGACCTAGAAATGTTGGGG + Intronic
1090341306 11:126023380-126023402 AGGTAAGAGTAGAATTGGGGAGG - Exonic
1092962679 12:13611104-13611126 AGGTAGACCTAGAGATGTGAGGG - Intronic
1093061658 12:14613669-14613691 GGGAAGGCTTAGAATGGTGGAGG + Intronic
1099082724 12:78206428-78206450 AGGTAGGACTGGAATTTTTGAGG - Intronic
1101154690 12:101916429-101916451 CGGTGGGCCTAGACTTCTGGTGG + Intronic
1101953553 12:109194802-109194824 AGGAAGGCCATGAATTTTGGAGG + Intronic
1106662983 13:31821801-31821823 ATGTAGGCCTAAAATAGAGGTGG - Intergenic
1109003761 13:56841658-56841680 AAGAAGGCCTAGAATTCAGGGGG - Intergenic
1110764414 13:79266489-79266511 AGCGAGGCCTTGAATTTTGGTGG + Intergenic
1112374663 13:98827903-98827925 AGGGAGGCCATGAATTTTGGCGG - Intronic
1126024391 15:44432106-44432128 TGGTGGGGATAGAATTGTGGTGG + Intronic
1130825414 15:87540175-87540197 AAGTAACCCTGGAATTGTGGTGG + Intergenic
1134349573 16:13424131-13424153 AGGAAGGGCAGGAATTGTGGAGG + Intergenic
1135301745 16:21334659-21334681 AGGCAGGCCTCGAGCTGTGGTGG + Intergenic
1137904503 16:52306639-52306661 AGGTAGGTCTAGAGTTATGGAGG - Intergenic
1140877725 16:79168581-79168603 TGGGGGGCCTAGAAATGTGGAGG + Intronic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1149189407 17:54041191-54041213 AGGAAGGCTTATAATTATGGTGG + Intergenic
1149395915 17:56243627-56243649 AGGAAGGACTAGAATTAGGGAGG - Intronic
1151816333 17:76473221-76473243 AGGCAGGCCTGGAGTAGTGGAGG - Intronic
1152298740 17:79483423-79483445 AGGGAGGCCTGCAATTGTGCAGG - Intronic
1153872089 18:9330906-9330928 AGGAAGGCCTAGAATTGAAAGGG + Intergenic
1155272313 18:24152870-24152892 AGGGAGGCCTTGAATTGGTGTGG + Intronic
1155571925 18:27203998-27204020 TGGTATGCCTAGAATTCAGGGGG - Intergenic
1161256311 19:3311818-3311840 AGGAGGGCCGAGAATTGTGTTGG - Intergenic
925943058 2:8838001-8838023 AGCAAGGCCTAGGAATGTGGAGG - Intergenic
926012112 2:9416690-9416712 TTGTAGGCCTAAAGTTGTGGAGG - Intronic
926359416 2:12071547-12071569 AGGGAGGCCCAGAACTCTGGTGG + Intergenic
929269365 2:39956737-39956759 AGGTAGGCTCAGAATTGTGGAGG + Intergenic
929459582 2:42092747-42092769 AGGTATGTCAAGAATTGTGAAGG - Intergenic
934011512 2:87825134-87825156 GGGCAGACCTAGGATTGTGGGGG - Intronic
934661658 2:96146381-96146403 AGGGAGGCCTAGGATGGGGGAGG - Intergenic
935293353 2:101627953-101627975 AGGTAGGCCTTGATCTTTGGAGG - Intergenic
935426075 2:102919556-102919578 GGGTGGGCCGAGAGTTGTGGGGG + Intergenic
937202225 2:120211085-120211107 GGGTAGACCTAGAATTGTTGGGG - Intergenic
937467809 2:122150139-122150161 AGGTAGGCCTTGAAGTGTCTTGG + Intergenic
939510672 2:143100559-143100581 GGGTAGGCCTAGAATTGTTGGGG + Intronic
940234007 2:151490231-151490253 AGAAAAGACTAGAATTGTGGAGG - Intronic
944741342 2:202615795-202615817 AGGTAGACCTAGAATTGTCGGGG - Intergenic
945454023 2:210028149-210028171 AGTTAGGTCCAGATTTGTGGAGG - Intronic
947136534 2:226981777-226981799 GAGTTAGCCTAGAATTGTGGTGG - Intronic
1169553611 20:6726713-6726735 AGATAGGCCTAAAACTTTGGGGG - Intergenic
1173222640 20:41142206-41142228 AGGTAGGCCTTGAATTACTGAGG + Intronic
1177823169 21:26054328-26054350 AACTAGGCCAGGAATTGTGGGGG - Intronic
1183886080 22:40883479-40883501 AGGTAGTCCCAGTATTCTGGAGG - Intronic
1185201627 22:49509532-49509554 AGGAATACCTAGAAATGTGGTGG - Intronic
950820772 3:15756086-15756108 TGGTATGCATAGATTTGTGGGGG - Intronic
951756641 3:26098006-26098028 AGGTGGGCGTCAAATTGTGGAGG + Intergenic
957497685 3:81011407-81011429 AGGCAGGCCTTGAGCTGTGGTGG - Intergenic
958143001 3:89587589-89587611 AGGTAGACCTAGAATTGTCAGGG + Intergenic
963090654 3:141480590-141480612 AGCTGGGCCTAGAAATGGGGAGG + Intergenic
970121516 4:12758322-12758344 AGGGAGGCCTACAATCATGGCGG + Intergenic
972760349 4:42097121-42097143 AAGTAGGCCTAGCTATGTGGGGG + Intergenic
975029589 4:69599225-69599247 AGGTAGGTCTACAACAGTGGAGG - Exonic
979138086 4:117135909-117135931 AGGTGGGCCTAGCATTATAGTGG + Intergenic
979727451 4:123980428-123980450 ATGTAGGCCTAGAATTTTCTTGG - Intergenic
981258465 4:142691364-142691386 ACATAGGCCTAGGATTGTGTGGG - Intronic
982443009 4:155458587-155458609 GGGTAGGCCTAGAATTGTCGGGG + Intergenic
983097879 4:163586387-163586409 GGGTAGGACTAGAAGTGTGTTGG - Intronic
986782158 5:11076255-11076277 AGGTGGGCTTTGAATGGTGGTGG + Intronic
992138282 5:73769658-73769680 AGGTAGGAATGGAATTGTTGTGG + Intronic
996700291 5:126444106-126444128 AGGTAGGCCAGGACTGGTGGTGG - Intronic
998052650 5:139048882-139048904 AGGTAGGCCTATACTTGGAGTGG - Intronic
1001811134 5:174629145-174629167 AGGAAGGCCTAGATTAGGGGAGG + Intergenic
1001966785 5:175915217-175915239 AGGTAGCCCCAGATGTGTGGGGG - Intergenic
1002250164 5:177923987-177924009 AGGTAGCCCCAGATGTGTGGGGG + Intergenic
1004222702 6:13760155-13760177 AGGTGGGCCTTTAGTTGTGGAGG - Intergenic
1005373516 6:25158696-25158718 AGGCAGGCCTTGAGCTGTGGTGG - Intergenic
1006445498 6:34077509-34077531 AGGTGGGACTAGAGTTTTGGTGG - Intronic
1010007311 6:71010231-71010253 AGGTAGGCAGAGAACTGTGGTGG + Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1012356467 6:98320318-98320340 AGGTAGCCGTAGCATTGTGCAGG - Intergenic
1012871810 6:104682063-104682085 AGGAAGGCCTATAAATGTGATGG - Intergenic
1015716837 6:136201503-136201525 AGAAAGGCCTAAGATTGTGGAGG + Intergenic
1016582058 6:145639429-145639451 AGTTAGGCCTATAATTCTGTAGG + Intronic
1026328293 7:69330142-69330164 AGGTAGACCTAGAATTGTTGGGG + Intergenic
1027613812 7:80395783-80395805 AGCTAAGCCAAGAATTGTGCGGG + Intronic
1032565851 7:132942100-132942122 ATATAGGCCTAGAATTGTATAGG - Intronic
1036081672 8:5563354-5563376 TGGTAGGCCTAGAAATTTGTAGG + Intergenic
1038791917 8:30675684-30675706 AGGTAGGATTTGAAATGTGGGGG - Intergenic
1039318829 8:36405393-36405415 AAGTAGCCCCAAAATTGTGGTGG - Intergenic
1040594451 8:48823994-48824016 AGGGAGGTCTAGAATTGCCGAGG + Intergenic
1042331808 8:67588352-67588374 GGGTAGGCCTAGAATTATTGGGG + Intronic
1043614166 8:82104730-82104752 AGGTAGGCCCACAGCTGTGGTGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051092566 9:13426873-13426895 AAGGAGGCCAAGAGTTGTGGGGG + Intergenic
1054738993 9:68785707-68785729 AGGTAGGCAGCGAATTGTGGTGG + Intronic
1055295120 9:74826145-74826167 AGGGATGTCTAGAATTGTGTTGG - Intronic
1055333471 9:75208127-75208149 AGGCAGGCCTTGAGCTGTGGTGG + Intergenic
1056280031 9:85032145-85032167 AGGAAGACATAGAATAGTGGAGG - Intergenic
1058209808 9:102153241-102153263 AGGCAGGCCTTGAGCTGTGGTGG + Intergenic
1059246081 9:112850750-112850772 GGGTAGGCCTTGATTTGGGGAGG + Intronic
1062171638 9:135138021-135138043 AGGCAGGGGTAGAGTTGTGGGGG - Intergenic
1202629986 M:8558-8580 GGGTAGGCCTAGGATTGTGGGGG - Intergenic
1185500836 X:596132-596154 AGGTGGACATAGATTTGTGGGGG - Intergenic
1188947496 X:36325114-36325136 AGGTATGCCAAAAATTGTGAAGG - Intronic
1190497418 X:51040117-51040139 AGGAAGCCCTAGGATTGTGGGGG - Intergenic
1190508565 X:51154191-51154213 AGGAAGCCCTAGGATTGTGGGGG + Intergenic
1190528828 X:51354486-51354508 AAGCAGGCCTTGAATTTTGGGGG + Intergenic
1192339844 X:70254940-70254962 GGGAAGGCCTAGAATTGAGTTGG + Intergenic
1193084460 X:77436953-77436975 AGAAAGGCCTAGACTTGGGGAGG + Intergenic