ID: 1011859466

View in Genome Browser
Species Human (GRCh38)
Location 6:91737162-91737184
Sequence TGGCCTTCCAAGCCATTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011859466_1011859469 21 Left 1011859466 6:91737162-91737184 CCTTATAATGGCTTGGAAGGCCA No data
Right 1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG No data
1011859466_1011859468 8 Left 1011859466 6:91737162-91737184 CCTTATAATGGCTTGGAAGGCCA No data
Right 1011859468 6:91737193-91737215 TTTCAAAGTCTTAGACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011859466 Original CRISPR TGGCCTTCCAAGCCATTATA AGG (reversed) Intergenic
No off target data available for this crispr