ID: 1011859467

View in Genome Browser
Species Human (GRCh38)
Location 6:91737182-91737204
Sequence AAGACTTTGAAATACAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011859467_1011859469 1 Left 1011859467 6:91737182-91737204 CCAAATTTGTATTTCAAAGTCTT No data
Right 1011859469 6:91737206-91737228 GACTCCATGGAGTTTCTCACTGG No data
1011859467_1011859471 16 Left 1011859467 6:91737182-91737204 CCAAATTTGTATTTCAAAGTCTT No data
Right 1011859471 6:91737221-91737243 CTCACTGGCACATTGCAGTGTGG No data
1011859467_1011859472 20 Left 1011859467 6:91737182-91737204 CCAAATTTGTATTTCAAAGTCTT No data
Right 1011859472 6:91737225-91737247 CTGGCACATTGCAGTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011859467 Original CRISPR AAGACTTTGAAATACAAATT TGG (reversed) Intergenic
No off target data available for this crispr