ID: 1011859468

View in Genome Browser
Species Human (GRCh38)
Location 6:91737193-91737215
Sequence TTTCAAAGTCTTAGACTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011859461_1011859468 24 Left 1011859461 6:91737146-91737168 CCTCACCTTAACAGAACCTTATA No data
Right 1011859468 6:91737193-91737215 TTTCAAAGTCTTAGACTCCATGG No data
1011859463_1011859468 19 Left 1011859463 6:91737151-91737173 CCTTAACAGAACCTTATAATGGC No data
Right 1011859468 6:91737193-91737215 TTTCAAAGTCTTAGACTCCATGG No data
1011859466_1011859468 8 Left 1011859466 6:91737162-91737184 CCTTATAATGGCTTGGAAGGCCA No data
Right 1011859468 6:91737193-91737215 TTTCAAAGTCTTAGACTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011859468 Original CRISPR TTTCAAAGTCTTAGACTCCA TGG Intergenic
No off target data available for this crispr